Description :
From Genome Similarity Track
Location :
Scaffold_60:189621- 193624
Transcript NameFunction/comments
Hyaar_Emoy2807198hypothetical protein
Hyaar_Emoy2807199hypothetical protein

Sequence
4003 bases(100 bases per row)
TTGTGATCATTCCATGGCAATTTGCGACGAGAGTCTTGCTACAAGTGTCGAAGGGTGGTGCTTGTCCAAATGGTGTCACGAGCTTAGATGAATGGCAATT
GGCGATAAGAGGATAATGGACTGGAGTATTTGGGTATCTCTGTCCGACCTCGAGGTGCAGCAACTCAGCTTTTTGCCTCTGAAGATGCAGTGGGGCTGCT
GCGACGTAGGGGATCATGGCAACTGGACTGTCGGCATTCGAGTGATTTAGGATCGATAACAGTTCAGAAAAGCTAGGACGACGTCGAAAATTCCATCCTA
GCAACAACCGAGACACCCCGGAGTGAGGGGCACGGCAACAGCAGTTGTCACCCCCACCTAATTCCTACTATTCTGCGTCAGCCTTTGAGTAGCCGGCCGG
GTCGCCGAGCATGACTCTCGAACCCACATCGAACTTGCCTAGAACGTGGTTTCCATCGGCCCAGTCCAGGTGCGTCAGCGGCCCATCGGGGGTGGTCGGT
ATGGTTCCGGCGTTTTCTGCGACTTAAGCGCCCTGTCTGCACCCCGGACTGGATATCCGATTCCATGTGACCTGTGCGGAGTGCCCTCCGTGATCTCCGT
AGTATGGAGCCAGCAGACTGAGCTAGCGAGAAGAAGATGATGTAGATTAGGTAGCAGCACCCCGATATCGTATAGTCATAAGCAATTAATCGACGTTCAG
ATTTTACTACTACGATGAAACGAGAGGTTCTGGGTCTATCGACCGATTCAAAGCGCATCTTGAGGCTGGATCTCTGTATAAGCGCATATAGCACATGCGT
ATGAGAAAATGGAATCTTGCACCTGTTGGACGGGCGACGTCGCACACCTTCAGTATACACGCCACGAGCAGTCAATAAGGCGCTTTCGCTCGAAGCACAA
AAGGATGCAGAAGGAATAGTTAACGATAGACGGATTTGGAATGCCTACGCTATTTGCTTCAGCGACCTGCGCTATGAGGTACCGAGTGACTTGAGTAAAA
TTTCATTCTGTACCTTGAACTACGTTTATGTTGCTGCAATTGGTCCAGGTTCAATAGCTGCTGAAGTCGCTGTCTTTCTCATCCATGGCGACCAGAAATG
TACGCAATCTTTTCGGTGTACCGAGGATAGCCTGCCGACACCCCATCTGGGCAGATCATAGTCCGTCCGCCACCCGCTTCTCGCCTTGGCTTGGAGAGTA
GCCGAGTAATGATTACGCGCGCCGAGGATGTATCCCGCTGCCCAGGTCAACTCGCAATCACGCCAGACACGAGAGCCAGGGCACACCAAGCAGCCATTGA
GCACACGGAATACCACTTATAACCAACGGAGTGTGGCAGGATATGTGGGGGGCATTAGTGGGGTCGTGGTCGGACTCAACTGGCGTACCCTTTCCCTCTT
TCGACAGCAGCACGGGGAAATGGCTTCTTGCCGTCCGCGCTAAATCGGAGAGGCTGATGACGTTGCTCCAAGCCTTTCCCCATCAACATACACTTCTCAA
CGCTCTCAGTGATGAAGTCGTCGTCGCCTGGACCTCCTTGTGGAGACGGGTAAGTATTCTGCGAAGCCTTCAACAATATAGCTATAGGCTGACGGACCGA
GCGACCCAAAATTGGATTGATCGGTGGAGGACGCGAGCTTCACGATCCCCGTCCGGGGCTTTTTTGGCCCCAGTGATCGACAGCACAGATGATTGGGTTC
AGCTTCGAGCACGAAAATATGGCAGTGATGAGCTTTTAAAGCAGTGTGATGTCAGAAACAAGTGGGCATTTGCACGTCACAAATTGTGCGATAATTCACA
ATGCGAACATCAAAGCGCGCATCGGAAAAGCAGCGGACGACGATGGAGACATCCCATCTCGGATCCGGCGCCATCTTACTGCACTCTGAGCACATGAGGA
TTATCGCCGTGTCTATCGCGACGCTTCCCAGAAACATGACTGGGTCATCCTGAACACCTTTCTCGAGACGACGCTATCCCACGAGTTCGGTCAACGGACT
CTACACTACTAAGGGCACCCAGCAAGACTGGCTTCAGCTCCCAATACCATTGGAGCAACGTCGCGACGTTTATATGGAGCATCCGCTGACACAGAAGCTA
TTCTCGCATCCCACCGCTATCCAAACCCACCGCCATGGCCGGACAGTGCATCCTCTATGTCATTCTCAAAATGTCCGCGGTTTCCCGCTTGCAGCTCAAC
GCTCCTGGATGGGTGGATGGAAAAAGCAATCTCATCGTAGCCATCCAAATGTGTGGAGACTACAGGAGACTCACATAGCCTCGGAGGTGGAGGCACGTTC
GGCAGCGCAATTGTGGACCTCCCTTTGGGGGCGTCAACATATTACACCTGTCGACGGGACTTCTTACTGGAGTGTGAGCGGCGACAAAACGGGTGGGGTG
GCACTATTACTAGACCCACGGCAGCGGCACGTATGCCAGCCTTGGCAACAGGAACTATGGTCCAAGCGGTTCATCGCACTTGTGGTGGACGACACCCTGT
TCATTGACGTGTATGCGCCCAATGATCGCCACGAACGAGAAGACTTTTTTGAGGGCCTGCGGCGGTGGCCCTGGCCACAGCTTGAAGTGATCTTCTTTGT
GAATTGTAATTGTGTTCAGAGTCCCCACTTCGATCGCCTGGGAAGCCGACGGTCTGGAAGACCGGAGAGCCCGGCTTCGGACAAGCTGATTTCAACCTTG
GATCCAGAGGACGCACAAGCACTGGCGTCTTCTGCACTCGAAGACGACGTCGTGAAGCCGCTCGACTACTTTACATATTGGAACGCCCAGTCCGCTAGTC
ACATCGATCGCTTTTACGTATGCAAGACATGGACTTTGACAGTTCAGCAGGTGCAAGTGCGGCTGCCAGTCAGTTTCTCGGATCATCTACAAAAACATTA
TACGTGTCATCCAAAGGCCCGCCCGTGCGTCATCGCGGTCAACCGCGGTTCGTTCTATATCCAATCCGCACCTCGGCGCCGACCCAAGTCCACGGTGACC
TCGTGGACGAGCTAATACGCATGGGAGTCGGCTGCAACGTCGACTCACGATCATGGGATACAACCGTACAGAAGTGTAGTACGAGTATTAAGCGCATTAG
GAAACGTGACAATCAACACTTGCGCAGAATGCGTCGGAGGTTCCGGATACAAGTGCGTACACATCTTCTCAGCCGGAGAGCCATACTTCAGATATTCAGG
ACGATCTTTGTACGGTACAGACCATCCGTCACGGCTTACGATTGGAACGAATCATGGAAAGTCTGCAGTGGCAATTTAAATGCGCCTCAAACTGGGAAAA
AGACCGAACTATTACTAGTTGCTTTGGATCCACGGGCAGCCTTGTTGCCGTGAGGACACGATCGCGAACCACTTCGCATCAAAATGGAGCCCGATTCTCG
GCTGCCCTCACAACACAGTACCGAAAACGAAATTGAAGGAGGCCCTAAGCGACTTTATCACCATGCCATCCGACCGCGTTCCACCAGAAGATAACGCACG
GCTTATGATGCCCAAATCGCTCTCAGAAGTAATGACTGCCATCAGAGCGCTTGACAGGCGTAAAGCCGCCGGCCCGGATGGACTGAATAACGACTTTCTG
AAAGATTTTCAAGCGCTTCTAGCATCTGCACTTGTCACAATTGGCAACGAGCTCTTGCAAGGCCGGACCCCTCCTCATTCTTTTCTGGAATGTCTTATTA
TCCCACTACGAAAGAAAAGTGACTCTATGGATGCAATGGATTACAGACCAATCCTCTGCTACAGACAGGCTACAGGATTGTCGCTAAGGTGATATCGCGT
CGTGTCCAAGACGTCATGGGGTTCCAATTCAGGACACACAGCAGGGTTTCGTCCATGGCAGACAGATATCTAAAACTGTCATGATGATGATGGCTCATTT
AACGTCGGCGGCACATGAACCAGAGCGAGATGCAGCATCTAGTAGAGCCATTTTGCTCCTTGATTTTCAAATGGCATATGATACGGTATCGCGGGAATTT
TTA