Description :
From Genome Similarity Track
Location :
Scaffold_122:18962- 20555
Sequence
1593 bases(100 bases per row)
CCCAAGTAGGCTCATCGTAGCCGACCCACTTAACCTTAAACTTTCGCTGGGACCGGAACGTACACGTGGATAATGGTAGCCCGTCGTCGAGGATTGCTTC
GACTTCATACTGGTTCATACTTGTGTCTGGCTCCCAGCTATCTTCAGGCAGTAATTCTTCGTCAAAGTCTAATCGCTGGGTCTCTTCGAGGTCGGCGATT
AGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAAAACCTGTATCCACTCTTGTCGGGTAACTCCA
ATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGATGTGCTAACTTCTTAGTCAGTCCCGACTTGACTCGCTCCATAAA
CAACCAGACTTGGTCTCCCTCTTTGAACAAGGATTCGGTGGATTCATCGCCTGGTTCTGCAACTCTATCGTCGTCATCTGCTGTGTTGGGAATAGATCGT
TTCTCCTTCTTGCTCAGTGCTTCGTTGTGCTCTCGAGCTCGTCGTGCCTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGGGCAACTTCTCGTTGTC
TGTTCGCTTCTCGGCACCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAGCTCGTCATAGCCTTGAGTGTAGACTTGGC
GTCCCGACCATGTACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAGTCTCTTGAGTTGTTGATAGAGTGTACCATCTTCTCGGCGATGTCATCCCAGTCG
GCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACTCTCTTGTTGACCGTTGGCTTGTGGTCGGTAACTCAGCGTAGC
TCTTGATCCCGACTGCATCATCTCGGAGAACGTTTGGAATACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAACTGC
CTGCAGACGCATTCTTCAAACACCTTGGCTAGTTCGAGTACCCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACAACA
GCAGTGCAGTATTGCCCCGCTGAGTTCGAGGTAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGAGTA
ACCTCTCAACTGTGGCTTACGCTTACTGGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTAGTAGTCGGCC
TTGACTCGGTGGTAAGTCATGACGATATCTTAATGCCCTCCTTCGATCGAGTTGTGACAGTTATGAAGTATCTCGTCGACCATAGTTGACGGGATCACCA
ATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCCTGTCGGCGAGTTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTAAGTACAAAGACTTCTGCGAC
TTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGACCTCAAATTCACCTCTCAGGTAAGCCTTCAGATCGGCCCACCTAAGTTCTTCATCTTG