Description :
From Genome Similarity Track
Location :
contig_19:189602- 191679
Transcript NameFunction/comments
g4337.t1hypothetical protein

Sequence
2077 bases(100 bases per row)
AAATGCTCGAAGCTCGAGAGTTTGACGAAGACTTCGCCCTGTTCCTACGCAAAGAGGTCTTCGGGGCGGATGAAAAGGGCGAGTCTGAAGGCGTCAAAGC
GCTCTCGTTGTTTGGCAAGCAAGAGAGTGTGAAGAACGAGCTGGAGACGTCAAAGTGCTGGTCGGAAGAGATGGAGAACAACTTGAAGCCCGAGGATCAA
GGCATTTACTGCGTTGTCCAGAAAAATGCTGGCACGTCGGTGCGTACGCTGGTGCTGTTCGGGTGGCTCCAAGACGGTCTGTTCCGAAAGTCCCGCCTGC
GTGATACTGCGACGTACGTGCTGCGCTTCTTGACGTGTCTGAGCCCCGACATGGTGTGCTGCCTGTCACCCGAAGATGTTGAGCTACTGGAGCAAACTGT
AGCGTCAATGAACTCGAACAACTTGGACGCCTGGAAGTCGTTTTCGGTCGCTTTCCACGTGGAGAGACAAGAGGAGGAGAAAGACGCGGTCGTGTGCGAA
AAACTGGGGAGTGTCTTGTTGCCATTGAAGTCCACCACGCAGAAGATTCAGCTGCTGAAGGGCAGCTATACCAGCCGTTTCCGTGGTGGAACCAGCTCCG
GCGACGAAATGGACCGAGGCATGTCACCACCGACTCGATACTGCGAAGGAGTTTGCGACTTGGCTCGCAGCTGAGTCGAAGCAGCGCAACCTGAAACTTG
AGGTTGGTGCCAACCGTGATTACTTCTGCACTGAATTGCTGAAAGCTGTCGGTAGTTGGCCCGAAGGAGAGCTGAAGGCCGTCAAGGAACTGCTCGACCG
AAGTCTCCAAACCTGCACCGAGCAGTCGAAGGACCGCGCCCAGGCTTACATCGAAGAAACTCGCGAGGAGTTGCTCAGTCAGATGGACGAGTTATTCGAC
TTGGACGTGTTGATCAAGGCGAAAAAGGGAGAGGAGCCCGCGTTCAAAAGTCTCAACGCGTACGTTCAAAACGTTCAATCGAGTCATGAAATCTGGAGCA
AGCTCGACCCCGAGACGCAAGCCGCGTTGAACATGCCCCTCCGTCTCAAGAACCAGATTAAGGCTATTGCCTCGGCATACCGAGGGCATCTAGCAATGAG
CGGGGATGCAAGTGAAGAAAGAGAAGCTCTTGCACTTTTCCTTGGCGAATTTGCGGTGTCGGACAAAAGTCTTTACCAGTGGCGATGGTCTTTGGGGGCG
AACGTGGAAAAAGGTTGGTGAACTGTGGAGGGGTCAAGATTCTGAGCTTCTCACGGACGAGTTTCGCCAAAGCATGGCGGACCCATTGCTTGAGGCGCGT
AAAACCTGGTACGAGGCTGTCGAGACTGTCCTCACCGCAGCTGAGAGCGTCTTGATAGTGCAATTCAGCGAGGAGAACGAACGTTCACTACGCCAATCGT
GCGAAGCTGATGAGCGCAAACTCATATCTGAAGCTTTCCGTGACCTACTCGGGTCTTGGCGAGAGAATCACGAAGGAGGTCTTTTAACAACTGTCCGTCC
GCGTGTGCGTCTGCCTGCACGTTTAATTTACTGCGACGTCCAGAAGGAGCACTGGAAACCAGCTACAGACCAGATGAAGGTGTTCAAGCTTGCACAAACC
GATGATGGGACATTCAGTACGCAAGAGCTAGGGAGTCATCGGCTGGAACCGGACGCCAAAGTCTTGAAAGCGTTCGCCATAAAAACCCACTGCGTCATCT
TGGTGACTACTTCCCCTCGGGGAACGTTGACGGAGCGCATTGACTTCCCGCTGGAACGGTCTCGGTGGGGAGAAAGCATCGGGAAGGTTACGTTTACACG
CCGTTTTGGTAAGCCCGCTTGGTTGTGCGACTTCAACGTTCAAGAGCGTGTCGTAGCCTTTGTCGAGGAAGCAGGTCGAGTGATTCTCTATCGCTTCAAC
GAGACGTTTACGTCACTTGAGATTTTCAAGCGGCTTGAGTTGTCACTACGAACGTCGCTGGTACTTCCGGTCGCAGATGTGCTGCTCGTGGATGGATCCC
TCTACGCAACCGATGCACACGGGTCGATCCAGTCGGTAAACCTGCGAAACCAGCAGACTTCGCGAGCTGTGCAGATC