Description :
From Genome Similarity Track
Location :
Scaffold_133:18959- 21686
Transcript NameFunction/comments
Physo_143239PREDICTED: similar to Gag-Pol

Sequence
2727 bases(100 bases per row)
CTCGCCAGGCTTGAAGGCTTCGAGTTTGGTTTTGATCCAGCGACTCGGAACTTCATGATTTTCAGAGAAGGGCGACGTGTGGCCGTGGCGACACCCCAAG
AAGCGACTTGGGGGTTCCAGGTCACTCACCCGTCTCGCGGCGACTTCGTAGGGCCTGAGAATCACCCGTTGTGCAACTACACGGTGGCGGAACGGGTCGG
CACTCTGCAGCTCTGGCACGAGTGACTGTGCCATACTTGCCCACAGTATCTCAAGACGATGGTCATCAAGGAGCTGGTGCGCGGCAGCAGGACACGTGTG
ACGCGTGCCACTTGGGCAAGCAGAAGAAGAAGAAGCACCCCAACAAAATTGGATCGAGCGACCAAAGAGTCGAATCAGGTGATCTATGCAGACTTACGCT
TCCCAAGCAAGGCGAATGGGACTCGGTACGAGGCCATCCTGGTGATAATGGACGGGTACTCACCTTTTGTCACGGTGCATCTGCTGAAAAGCAATGCAAG
CGAGGTCGTGAACAAGCATCTCAAAGAGTACGTGTTCTGGGCGGAGCGGCAAGCTGGACGACTCGTGAAGAAGGTGCTCACGCACACGGTGAAGCCGGTT
CTCACGGATAAGGGCGGCGAGTTTGTTTACGAGGCAATGGAGGCGGCGACGTGCGGTTCGTCAGTGGTAGAAGACGAGCTCGAAGACGCTGAGATTGAAG
CTGATTCTGATGAGGAGGAGATTACTCTGGCGAGTGTTTTTGCCTCAGACGAAAATGAGGTAGACGCAAATGTGTCTAGCACTTCCGGGCTGGAGGAGGA
TAATGGTGAGCTCAAGATGGCAGATTCTACGGGCTTGCGCCGCGTGAGCGAAGGTGGAAGCGGCCAAGAGGAAGTAGCGATGCAAGTATGATGTTCTCAC
CGGCTCCAGCCCAGACACGGAAGTGCACGCATCATGACGAGACTCCGTCCGAGGACGAACGCGTCGAGCATGGCGCCGCAAAGCCTGAAGTGAAAAAGAC
TCGCACGGGGCTTCACGAGTGCCAGGAGCGCCGGCTACCTCGATATCTGGACGACTACGTGCCGAATCTCACGCCGAACAACGCTCGTGTGCTGGACAAG
AACGGCTGGCCAGTGAAGTCAAAATCCCTCGCAATCGCAGAGAGATGATGCGCTCGAAGTAGCGGGATATCTTCCTGATGGGAGAAATGGAGGAGATAAC
TGCACTCAAAGCCAAAGGTGTCATTATGAAGATTCCTGGAGATGAAGTTCCTGCGGACGCTCAGCCTATGAACACCATGTGGGTGTACGCTCTGAAATCG
GACCCTTTTGGCTACGTGGTTCGATTCAAGGCGCGCATTGTAGCTCTGGGGAATTACCAGCGCCCTGGTATCGATTATCGCGAGACCTTTGCACCAGTGG
TGAGGATGTCCTCTCTCAGACTGCTAATGACGATTGCTGCAAAGCTGAGGCTAGTAATGTACGGTGGAGATATCAATACGGCGTATTTGAACGCGTGGCT
GGCTATACGGCAGTACCTGCGCTCCATCGACGGATACCCGTGCAAGGTGAATGGTCACATGTACGTGGTGCTCAAGGCGCTGTACGGATTGCATCAGTCG
GGTCGTGAGTGGAATTCCGAGCTCAACCAGTGGTTCCTCGATCGATACCGGCGATCGCTCACGGAGCCGTGCCTGTACTACCGCTTTGAAGGAGAGACCA
TTGCGTACGTGCTCGTCTATGTTGACGACATTTTAGTTGCGACTAATCATGAGCAGTTCAAGTCCAAGCTGTTTCGAAGACCTGAACGACGCATACGGGC
TGAAAGGCCAAGGACTGCTGTCACAATATGTAGGAGTGGAGGTGCAGCAGACACACGAGAGTATCACTATTTCACAGGGCAATTACGCGGAGAAATTCTG
GAGAAATTCGGGTACCTGGAGGCACACGCTGTATGAAACCCTAAGGAGGTAAACGTGAGACTGGCCCCGCTGGACGAAAACGAGGCAACGGACTCAAGCT
TCCCGTATCGTGACGCACTCGGGATGCTAATGTATCTAGCGACCAGCACGAGACAAGATTTGGCCTTTGTGTTGGGGCAGCTAATCCGATTCGTCGCAAA
CTCGGCGGTGAAGCACGTGGTTGCACTGAAACGAGTGCTCCGTTATCTTGCTGGCACGCAGGACTACGGGATTACCTACGCAAGACAGCAGAGCAGTGTG
CATGAAGTGGAGCTCGAGGGATTCAGCAACAGCGACTGGGCGAACGACCCTGAGCAGTGGAAGAGCACGACCGGCTTTGTGTTCCCACTTGCTGGAGGCG
CTGTTACGTGGATGTCTCGTCCACAATCGATAATCGCTTTGACGACTGCTGAAGCGGAATATGTAGCTGCGTGCGAGGCGACTATGGAAGCAGTGGCGGC
AAGCAACGTTCTGCAGGAGATCTTGCCCAGTTGCGCTGTCAAGCTGCGGATCGGAATCGACAACCAAGCTGCACATGTGATGGCTACAAATCCAACATAC
AGTCGCCGCACGCGTCATATTGAGCTCCGCTGGCACTTTGTTCGGGAGCAGGTGCAAAAGGGGGGCATCGAGCTGCACAAAGTGACGGGCGAAGATAATC
CTGCAGAAAAGGCATCTGCCTTTACAAAGGCGCTGGACAAGAAGCGTCTGAAGGATTTGCTGCTGCTCATGGGCATTGCAGGTGCCAAGTAGTTGAAGAG
CGAACTTCGATGTGGAAGAGCGATCTT