Description :
From Genome Similarity Track
Location :
scaffold_222:18958- 20766
Transcript NameFunction/comments
Pl_107441myosin-like protein

Sequence
1808 bases(100 bases per row)
AGTCAAGCCATCCTCATTAGTGGTGAGAGCGGCGCCGGCAAGACAGAGGCCACTAAGATTATTATGACCTACTTCGCCGTCACGTGCGGTACAGGTAACA
ACAACCTGGCAGCTTCAACAACAGGTGAGACAGGGCCATCTAATTCGCCGCCTGCATCGCCGTCTCGCACGACGATCGAAGAGCAAGTACTGCAGTCAAA
TCCGATTTTAGAGGCGTTTGGCAACGCGCGCACAGTGAGAAATGATAACAGCTCGCGGTTCGGCAAGTTCATTGAGTTGCGTTTCCGCGACAAGCGGCGG
AAACTTGCGGGTGCTCGCATCCGAACGTATCTGCTGGAAAAGATCCGAGTCATTAAGCAAGCCCCCCACGAGCGAAACTTTCACATTTTCTATGAGCTGC
TGAGTGCAGACAACAATTGTGTGGGTAAGGAGCAGAAGCAGGCACTGGCGCTGAGCGGTGGGCCTCAAAGCTTCCGCCTGCTGAACCAGAGCTTGTGCTC
CAAGCGGCGCGACGGTGTGAAGGATGGAGTGCAGTTCCGTTCGACTAAAAGAGCCATGCAGCAGCTTGGCATGAGCGAAAAGGAGATTGGTGGAGTCCTG
GAAATCGTGGCAGCAGTGCTACATATGGGAAACGTGGACTTTGAACAAATACCTCACCAGCGCGAAGATACTGTGTTTGCTGACGAGGCACGTGTGGTGA
CCTCAACAGTTGGTGCGTGCGACCATTTTACAAAAGCAGCAGAGTTGTTAGGAGTGTCCACGGAAGCATTGGACCACGCACTCACGAAGCGCTGGCTGCA
CGCTTCTAATGAAACTCTGGTTGTGGGAGTCGACGTTGCTCATGCACGGAATACTCGCAATGCGCTAACTATGGAGTGCTATCGTCTTCTATTTGAATGG
CTTGTAGCACGCGTCAATAACAAACTCCAACGACAGGCTACACCATGGAATGGAGACCAGAATGATGACGAGGAGGACGAAGATTCGAATGATTTCATCG
GTCTGCTCGATATCTTTGGTTTTGAAGATATGGCTGAAAACTCCTTCGAGCAGCTCTGTATTAACTACGCCAATGAGGCACTACAACACCAGTTCAACCA
GTACATTTTCGAGGAGGAACAGCGGTTATACCGGGATGAGGGAATCCGTTGGAGCTTTGTAGATTTCCCAAATAACCGCGCATGTCTCGAGCTGTTTGAG
CACCGGCCAATCGGTATCTTCTCGCTTACGGACCAGGAATGTGTATTCCCCCAAGGCACAGATCGTGCCCTCGTGGCCAAATATTACCTGGAGTTTGAAA
AAAAGACGCTGCACCCGCACTTCTGTTCAGCTCCTGTGATTCAACGCACGACGCAATTTGTAGTGGCGCATTATGCAGGATGCGTTACCTATACCGTTGA
CGGCTTCCTTGCAAAAAACAAGGATTCTTTTTGCGAAAGTGCGGCCCAGTTGTTGGCTGGTTCTTCAAACCCGCTTATTCAAGCTCTTGCCGCAGGATCG
ACCAAGGAAGATGGTGCCACCGCAGACAGTGAGCTGGATGGTTTTGGTGGAAGGAATATTCGACGTGCCAAATCTGCAATTGCAGCAGTCAGTGTGGGTA
CGCAATTCAAGATCCAGCTGAATCAATTGTTGACTACCGTCCGTGCCACTACACCTCGATATGTGCGCTGCATCAAACCTAACGACTCGCACGTGGGTTC
TCTTTTCCAAAGCACACGAGTTGTGGAGCAGCTACGCAGTGGTGGTGTTCTTGAAGCTGTGAGGGTAGCGCGTGCTGGATTCCCTGTGCGTCTTTCACAC
AAGCAGTT