Description :
From Genome Similarity Track
Location :
contig_13:189577- 191144
Transcript NameFunction/comments
g2404.t1Cleavage and polyadenylation specificity factor protein
g2405.t1hypothetical protein PHMEG_0003383

Sequence
1567 bases(100 bases per row)
AACCCGTTCCAGTTTGAGCACATTTCCAACTTGAAGAGCATGGACGACTTTGACGACTCGGGCCCGTCGGTTGTCATGGCCAGTCCTGGTATGCTGCAGA
GCGGTGTCTCGCGCCAGCTTTTCGACATGCGCAATGCTTGTCTGATTCCTGGTTATGTGGTCGAGGGCACCCTTGCCAAGAAGATTCTGTCGGAGCCGAC
GGAGATCGCTGCGCTGGATGGACGCATCATCCCCATGAACTGCACGGTGGAGTACATTTCGTTCTCGGCACACGCTGACTTTTGTGGGTACGAGCGGCTT
CGTGGAGAAGCTTACACCCCCGAACATCGTGCTCGTCCATGGTGAGAAGAACGAGATGATGCGTTTGAAGTCGGCGCTCAACAAGAAGTTCAACGACCCC
AAGGTCTACCACCCGAGCATCTTTACACCTGCCAACATGCAGGAGATTGTGCTGGAGTTTAAGGGCGAGAAGATCGCCAAGGCTATCGGAGGTTTAGCGA
GTGACCAGCCCAAGAATGGCAAGGTGATCTCAGGTTGCTGGTGAATGGAAGGACTCGCAGGACGCATTTGATGGACAAGGAAGATCTGTCAACATACACG
AAGCTCATCTCGGGTAGCATTACACAGAAGCAGCACGTGCCATTCGAGTACAACTCGTTTGACGTGCTGATCACCTTCATTCGTCAGATGTACGAGGACG
TCGTGCATTTGGAGAAGGAAAACCGCGTCGTAGTGTGTAAGCAAGCCGTTGTGACCCGATGCGCTGTTGCTAAGGGTGCTGCGGAGAAGCTTGTGATTGA
ATGGACATCTGCACCGACGGCTGACATGATCGCCGACTCGGTCATTGCGCTAGCCATGCATGCCCAGGCAAGTCCTGCGAGTTTCAAGCTAAGCAACCAG
CCTACGGCTGCATGTCCGCATGACCACTCCAAGAAGGCGGACGCTACTGAGGAAGCTATGAATGACGAAGACGCTGTCGTGACACCCGAAACGGAAGAAA
CTCCTGTTGTGGAAGCCAAGGACATTGCTGAAGATCCTGTATCGGAGCAGCCCCATAAGAAGGAAGACGGGTCTGACCTGGAGAAGGCAGCGCAGGAGCT
TGGAGAGGCCGACCAAGACGCACTAAACTTGCTGATCGTGTTCCGCCTACTGAAGGATCAATACGGCGATGTTGATTTGGACTTCGAGACCAACAAGATT
CACGTGCGAACTCCAAGCGGCATCGATGCCGTAGTCGACCATGCTTCTCGGGACGTCGAGTGCAAGGACGCAGCTTTCAAGCTTAAGCTCCAGACGACTG
TCCGCCGCATTGAAGGTGCTCTGAAGCCCATTGCATCATCGTAAGCGGTGCGTTGCTAGCCAGTCTGTGAAAATGCTGCACAAACAATTCACCTATCTGC
GTTTACGGGGAGTTCCACGCCAAGAAAAATACGCGTTCATGATCAGACTATCCGTTGACTTCACGCAATATATTCACCTCTTTGAGAGTCTTTTGCAATC
TAACTATCAGTATCATCGTCGTGAGGGCCTGATGTTTTACTGCTCGCCCTCCTCTTTAGCATCATTC