Description :
From Genome Similarity Track
Location :
Scaffold_170:18955- 20271
Transcript NameFunction/comments
Phymu_g5979hypothetical protein PHYSODRAFT_481940
Phymu_g5980hypothetical protein PHYSODRAFT_539377

Sequence
1316 bases(100 bases per row)
CAAAGAGAAGCCGAAATTCCGCCCAAGATCCGCTGGTACCAGTTTGGGTTTCCAAACGAGTTGTTCAGCACCAAAAGTAGGGGATTTATTAACTCCAGAG
TTTAATGGAGGTGGGaaagttgctggagcacgtcGACGGCCTCATTCAGCCAACATCACGTACTTTAAACACTCGACAGTTTACTGTATGGGGCCCTCAA
CGCCGTCCAAAACCGGttgtgtcgctgctgcaacggaTTTCCGGAGTGTAGTCGACGTTGAGTGCCTAAAGCGACAACGAGAACGTGACGACACTCTGCA
GAAACTTGCCAAGcgtggccttctccactCAACGCCATTGGCTCAAGTGTTCGCCAGGTTGCGGCGTGAAGGACTTATGAACATCGACCGACGATTGCAA
CGTAGTCTCTTCGAGCGGAtgacgctggacgagtacatgaGCGCCTGCGGCTGTCTGAATGTGGCGCCACCgttgacagcagcgtcggaGAGGAGGCAGA
TCGAAACTTCACCGGTTAAAGAGGTTAAGCGGTTCTCTCCAAACGTGAACGAAGCGGATTCCGGTGCAATTCCATCGGTAGATGCGTCGCCGTCCTTGGT
AGCAACGCGCAAAGCTCTTGTCGTATCGCGACAGCAGTTCCACTTGGCTCTTGAAGCTTTTAATTTGTCTCCGACCGACGTCAACTTTCTCTTCTCGGCG
TTGGATCTCACAGTGAGCGACTTTGTGCAGGTTTGGGACGTCATTTGCATAGTTGAAAGCCTCCAGCATGACCATTCGGCGATTCGACGAGCGCGAGTGC
AACAACTCCAAGCTCCACCGACAAGAGACCTCGATTTCTTTCGTCGTGCAAATAATTAAACACGAAAATTGACACCagttttttgttgttgtatTTGCAT
TGTTCCCGAATTTCCTACTAGCAGCACATTGCGATCTGGTGCTGCATCGCTTTAGAAATTGTGGGGATTCatagagagagagagagagacgTAAGACTTT
CGCTGTGTGGCTGGCAACTCACTTCTCACCGCGATGAAACCATGCTATTGCCCACTCGAAAGCTTCCTAGTGCACCGAGAGGTCCAAGCGGCTGGCACGG
ATGAAGATGCCGTGGTTCGGAGGGCAGCTGAAGTACTTCTCGCCATCCACAGTACCGCTGTTCTTGCCTTTTTGCTCACAGAGCTCGATACCCACCCACG
TGCCGGTCGCGAACCTCGTAGTACCAATGTAGCGCACCACTCCAGCCACATTCCCAACGTTGATAAGCTTCCCAACGCACAACGGGGCGCCGTTGATATA
CACGACGTTGCTGCCG