Description :
From Genome Similarity Track
Location :
Scaffold_65:189521- 193091
Transcript NameFunction/comments
Phyca_LT1534205103'5'-cyclic nucleotide phosphodiesterase, putative
Phyca_LT1534530472protein phosphatase 2C putative

Sequence
3570 bases(100 bases per row)
tgcagtgaacaaagtggacggaatggatttcactagtgaagacgctgttttcctgaattacgcagctgaagcagtcggtacatcgctccacaaagcgagt
ttgcatcgcgaagtcaggacgtcccagaaacttatcgaagcgcggttgagactcacaacttttatctcggaaagcactgacattgccgagttcgtggaca
tggtcatggagttgggtaaggatattatggagtgtgatcgctttggatttctacttatcgaccatttcaaacatgaactttggattactccacgcgttgg
tggtgagagtatccgctcgcccatcaaccgcgggatttcagggctagtagctactactggcgagactgtgtgtactcgagatgcctacaagcatgagctc
ttcgacccaagtgtggatatgaagacggggtatcgaactacaagtgttctttgcatgccggtattcgaagatcactcaatcacgatccctcctaaggtag
ttgctgttgcgatgtgcatcaacaagaaggaaggagctcacgttgtcgccttcactaaaacggaccgtgaaatcatgaccaagtactgtgctgaagtgca
gtttgcgctcgggcgactatcccttgatatctcgtactacaaggtcgtgtcggactgcgttgcagtgtcacgtacaggcgtagactcgagtgcgagagtg
ctgaagcggatgtcaaccacaaaccgcattgacaaattctccgagaccgacatcatttcgtccattgtacacaagtactgccactccggcgacgagcagg
ctagtgaaagccagaaaaaagcggtaccctcctttgcagcgttgctgccagtcatcaagaagaagagtcacgaagatgatgaagtgccattcccacgcga
aatcctcttcacacatggacgagatgaaccgctggaccattgggataccgaaacaatctcgctttcgagcagtgaggtgtctatgagctgtggggttatc
tttcgtgcatatgggtttatggatgctttccgggtttccagtgagaagttatcggcttttacaacgaatgtggcgaattactatcgtagcaactctttcc
acaactttcaacacgggtttcaagtgatggttgctatgcatatcatgctacgtaccgagtgccgccggtacttcagcggtctcgagatttttgctatgct
gattgcctctttgtgtcacgatatcgaccatccaggaaataccaatgacttcgagctgaagatgctgagtcctatggctctcacgcacaacgatgatgct
gtgttagaacgtcatcactgccgagtgactttcatcattctcaaccacaagtccgcgaagatcttgcagcatctcgaccgggagcgccagaaacgagtgc
gacaattaatcatttcgtgtattctcgcgacggacatgtcgaaacactttgagaagtgcaaagtcctcgaaggtcttacacgtcgacagcttggagataa
acgcccaatcttcatggggcctgatgcacgcagccgatatatcgcactatgcgctgccgtttcctcaggctcaagagtggggagctcgcttgctcgatga
attccagaaccaagccgctgctgaagccgaacatggtgttcccaccgactatttcatgcagaacctggagaacaagcgcgttcggatcactgtgcatctg
agcttcatcaactacgtcgtgcgtccaatttggctgccattgacttcgctttgtcatcaccttcgggtacgctgcgtgttctgctgtcagaatttgcata
caggctatatactaactgctttggtgctgtagttttacacagattcgctcgagaaaaactacgagacgtaccgacaacaactgagcaagaatacgagtaa
tgtagctccaaacccctcggcagctacgacaccattgccccctcaatctgctagcagaaacatattgccttcctctcctcgtaatacgcataataattcc
agttagttggccaagagaacgggtcagccctcgattatcgtgccattattgttgtccattgtgcattcctttgcgtgcatcaaggctacttggcaaacgt
agcctcaactcactctagtcaaagaacagaacgaccaccgtcgtgtcatcgtgccgacggcggcggtggcttccaggaggtaagctcagcagctcctgat
aagtcattccgtagcgcttcgccgccttctggagaacgcgctcgacaagcgcacggcctgcaaggtcgtgattgccgcaggaggcttggccattgacgat
ttcaactgcttcttcgttgctgaggtagtcccacagaccatccgaaccgatgatgaggaacttgtctccctccgtaagcttgtgcgacttcacttccgga
atagcggtgatgtagggcggagtgtaaggtgctgaaaaatgacgaccagcagatcgatcgccgttcttgtacggcggaccattaaattctgggtgtttga
gggagaagtcaccaaacgcacgcgtgggctgtagtgcccccttcacgtagcacgagtccgggtggcgacacgtaaaagcattcgcctctccagggtgctc
tttgagtagcttctcctgctcaaatttcaccatggcattctggtcattactgagtggttctgcgacaatagtgtcgggctccttgccgatctttcccaac
accgcacgaatgtcaccagcattagcaacatgaacactgccttcgtgcacgtaggccagacacgcacacgacccgcaacgtgctacagctccgaatccga
gctgaaagcggccgccacctctgacatgaggtcgcggtccgtacgtccgaacgcacgctggatagcagcagccacgcggtcatccgataccgtctcctcg
tctccttgagctggctcagttgtgcccggcttgtacagatacgacagctccttctgaacattgccgatcaacgtttttcgcgcatactccgacacctgcc
agccacctgcaaatacacacaaaaggatcagtacaacaaaaaatctttagtgtaaagcaaaaagccgtaccatggccatccagcacagctgcaaacacgt
ctccggagtcggtcgtttccaccgcgtatttgtcctcaatggggaaattggccttgtacgacgcactactgagtcgcgtggcgcgcgacttggcaatagg
cgcgaactcctcacgctcgagaggcacagagaaagctccgtccacttcgggtggcgcgtagcgggcatcacactgggcctctaagtgggtcgagctcata
tccgtgagctcggcatgggcaagcgccagcactgatagccccaggccgcttagaagcagcgcctgacgcaatgctgatccatgaccctgcagcgaagaaa
ttacagggtgagtttggatcaaagattgtgagcttctataaagcctaatttgccagcgagagcgtcattgcgtaggtataagaaaggggaagtaagagat
gaagtgtactcgtaccttgtggccctgtccgcgcgttaaacgcgccaggtttcgcgctgcaaaaagtcgc