Description :
From Genome Similarity Track
Location :
Scaffold_287:1895- 3542
Sequence
1647 bases(100 bases per row)
ACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGAGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCT
TAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGC
CCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTG
TAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGGGTCCGGCTGACGAAGGTGACTG
GATGACAGATCCCCACATGTTCTTGTACCATAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTGGGTTGACGTTCTGGATCGAAATGACG
GAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCGCGAATGCGTGCTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTC
TCTATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGAT
CCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCGGCGAAATCTACCTCTCTCAATTCGTACAATACCGCGGC
AAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAAC
GAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGA
TAGAAAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTCGAATGTCGTCGATGTAAGA
TCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGAC
TCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCTTTGGTAGATCTGGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAAC
AGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTA
CTTTATCCAGATCTTCCAACAGCTCATTGATTAGAGGCGTCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTAT
ATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCC
GATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGC