Description :
From Genome Similarity Track
Location :
Scaffold_2:18949- 20256
Transcript NameFunction/comments
Physo_127425hypothetical protein

Sequence
1307 bases(100 bases per row)
TCTTGACAACAGCCTTCGACTGCTTGAACCACTTGGAGGGAGTGTAATACTTTCAGTAACCTCGGCGTTCACCCGGCGACAGTCGAAGGGCCATCACACA
AAGGCGACGCGAATAGTCATCTTCATCCGAGGTAAGAGATCTGGCTGTATTCACCGCATTACAGGAAGTTGGGTCTTCTAACGCTCGCGCCTTCCTCTAA
ACATATGCATAAATGCAGAACTTCGATCGCTCGTCACGTACCAGGCTGTTCAGGCCTGGCGAGCGGTCTAGTTTAACGCCTTCTCGACGCTCTCGGGCAG
CAGTCCGGCATGGCGAGTCGGGTTGTACCGTTGGCGAACAGCATCGAAGAAGTCGCCGATTTTACACTGACCTGCTTCGTGAACGTCTCCACAGCACTTG
CAGACGTAGAAGCACTTGTCGGTAGGATGGCCCATGCGTCCACACTTCTGGCACGTGAGCCTCTTCCAGCACCCGAGATCCGTATGCTTGCGAGATCCGC
AGTGTGAGCATCGAGTGCCGTACTTCGGACGCCCCCGTTGGTCTTTGCGGTCTTGGCGCGCCCCTGGCTGTTCACCATCTCCTGGTGTAGGCATCCTAGC
TGCCGAAAACACGTGCGCTCTTTCGTCTTCAGATACGCTATCAGAACTGCTTGATTCGCCCTCGAACTCGTTGAGATCTCCGTGATCTCCGCGGCGTCCG
CGACCGGTAGTCACAACCCGCACCACCCTCGAGGAGGCTGCAGGGGCAGGAGCCTTTTGGCGGTATTTCGAACCTTGGGTCTCAATCTTGCGACGTTGGT
GGCGGCGTCGCATGGCCAACAGGACGCCTTCGAGAGCTTCTGAGTCAGGCAGCCTCAACACTACCAGAGATCCGGCGAGATCGTCATCTTGGACTGTATC
GATGTAGTGGTCGACGTGTTCACGTCGTTGTTCCTTGGTGCCATCATGGATCTTCAAGTTTGCAGTTATCCCGGCCAGATTCAGCCGGTATAAGTAATCC
AGTGGGTCTTCCTGACTCCCGCGCCGCATGTGGTAGTACTTGCGCGCGAGGGAGATCCCTTTACCGCAAGAGTGGATCTGGAACTGTTCACCCAGGTCAG
TCCACGACGCGCAAGCGGTGCGGCTCAGCTGGTAATACCAATAGCGCGCAGGGCCTCTCACCAAATCGGCTAATGTCAAGCACATCTCGTCTGGCTGCAT
CTGATCCCGTCGAAAAGCCGTTCTAACCTTGTTGAACCAGGCTCGGGCGGCTTCTTCGTCATGTTCCTTGCCGCTGAAGCCCTTCAGTTCGGACACAGCC
GATGCTC