Description :
From Genome Similarity Track
Location :
contig_28:189480- 191785
Transcript NameFunction/comments
g5613.t1hypothetical protein

Sequence
2305 bases(100 bases per row)
GGAGTTCGGCACGAGATTGACCTCGTGTCTGACGCGAAGTACTGTGTGACGCGACAATGGCCACTTTCCCGAGACCAAGGCGAAGCGATCGATGCCTTCT
TCGAGGGTCGCCGACTAGCCGGCCACGTTCGTAAAAGTATCTCCCCGCATTCCAGCCCGACGTTCTGTGTGAAGAAGGCTACTGGCGGATCCTTCACACC
TTTAACAAGCTCAACGATGCCACCACCCCGGCGCAGACGCCAATTCCGCGAAAAGACATGGTGCTCGACACCACGTCTGGCAGCACCTCATACAGAACTA
TCGAGTTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGACGACGTGCCGTTGACAGCTGTCATCACGCCTAGTGGAATGCTGCGGGAATGGCTTGA
AATGCTGCATGGACTCAAGAACGCTCCGGCTACCTTCAACCGGATGGTCTCCAACCTGCTGCGGCCTTTCCGTGACTTTGCGCCTAGCTACTTCGATGCA
TCTTTATCCTCAGTCATGCCGCGCGGCATGACTGATGTGCACCTGGATCACCTCCGCCAAGTGTTCGAAGTGATGCGAGACAACAAGCTGTACCCCAACC
TGAAGAAGTGTATCTTTTGCGCTCCCGAAATCCCGGTGCTCGGGAGCTACGTCAGCAAGGAAGGTGTCCGTGCTGACCTGGAGAAGATCGAGGTCATTTG
TGCATGGCCTCCACCCCAACACCAGAAGCAGTTTCGCCAATGGCTCGATCTCGCGACGTATCTCCATTATTACTCGAAGAACTTCGCACTGATTGTTCGT
CCACTATCTCAACTGCTCAAGGCAGATGCCACGTGATCATGGCGACTCGAGCACCAGATGGCATTCGACGCGGTCAAGACAAGCCTCTCCACATCGCCCT
TCCTGATGTGACACGAAGCCTTTCCACGTGGTGTGTGATGCGAGCGACTTCGCCAGCGGCTGCGCCCTGATGCAGTTCAGCGACGAGGGACGCGAACAAG
GGGTGAGTTAGTTACCAGTTGCGTCAGTTGAAGCCAGTGGAGAGAAATTATCCCGTCCACGACAAGGAGCTGCTACTGTAGCAATGCGCTACACGCTCAT
CCAGTTCCGACTATACCTTCTCAGCGAACAGACATTCGCTATTTTCAGTGACCATGCGTTGCTGAGGACAGCGACGAAGAGTCCCCTCTAAGTCAACGCA
TAGCACGTTGGTTCTTGCTGTTCTACGAGTACGCTTCGTCGTGCACTACAAGCCGGCAGATGAACATACTCATTGACGCACTCTCGCGTTGACCTGATTA
CGCGCAATCAGGTCGCCACGCGGTTGGCGACGAGGATGACGATGAATGTGCCGTGTGTGTATCTGACGAGTTCGCTGCCGTCGAGGTCGCAGCGACTAGT
CCGCTCCCTGACGTGATTATATCCGCGTACGAGTCGGACGCGACATGCTCCGAGATGATCAAATACCTGTGAGCCCTGTCCGACGCGGCACGATGTCTAC
TGTCTCCGCGTAGCCGCGCACTTATCGATCGATACGCGCCGGATGGATCCCTGTTGACTTACTGCATCGACCGCGAGGATCCTCCGCGCATCGTCGTACA
GTTGGGCGACGACCTTCGAGCTCGCCTAAGTCACGAGTTCCATGCGGCGGACACCTCAGTCGCGAGAAGACTTTTACTTCTGCTCTCTCGCGGCTTTGAT
TGAGCCCACATGCACAAGTGGGTCCGGAAGTGGGTGCGATCCTGTGAAGCGTGTGAACGCGTCAAGCCGGCTTCCTCGCGCCAAGCTCCGCTACATCCAC
TACCAATTCTGAGTGATGCTTGGCAATCGTTGAGCATGGACTTTGGTTTTGGCCTTCCTCGAGGCAGCCAAGGGCTTACGGGTCTCCTGGTCGTCGTTGA
TCGGTTAAACAAGATGACCCGTCTTGCTCCAGTAGCTGTTACCGTCACGGTAGCCCAAACGGCAGCGATTTTCATTGACACGGTCTACCGCCATCATGGC
TTACCGACCACGACCGTGTCTGATCGAGATTCTTGCTTCACTGCAGTATTTTGGCCAACGCTCTTCAAGTCACTCGGGACGCAGTTAGACATGTCCACCG
CGTCACATTCAGAGAAGGATGGTCAGACTGAGCGTATCAACAGGGTCATGGACGATGTGCTCCGAAGCTTCGCCACGACGTTCAAGTCATGTAGGACGTT
CTTCCCAATGGTGGAATTTTCAGTGAACAACGCTGTCAACGCTTCAACTGGTCTCACACTCTTCAACGTGAACTACCGTCAGCATCCTCGAGTTCCAGCC
CTCCT