Description :
From Genome Similarity Track
Location :
Scaffold_62:189415- 190440
Transcript NameFunction/comments
g17452.t1hypothetical protein

Sequence
1025 bases(100 bases per row)
ACAGTTATCGCGACGAGCGATCCAGCCCAAGCCCCCCCTGAACGCATGCAATCGTTCTTCAATGCAGCAATGGAGCGTTTCCTGAAGGAACAGCAAGCGG
TCTCGACCACGCCAGTCGTCGACCAAACCAAGCCACCTGGAGCTCAAGACGTTGACATGGAGTCCGTGGAGTCGAATCGCCGGGACCATTCGCATCCGAG
CGAATACGATCCGGATGACCTGGGTGTCGACGCTACCCCTCGTGCCGCAGTCGCATCTGCTGGGACTACAGGCGGCGGAACACTCTCAGCCACAAGGATC
CGAGTCTCCACGATCTCAGAACTGAAGGAATTTCCGGGGAAGGACAACGACGAAGATCGTGCCAGAAGCTGGTTCGGCAAACTGAAGTCTGCCTTTGTCC
GCGATCAAGCTCCTGACGGCGAGAAGTGTCTGGTGTTTGGAGATCTGCTCACTGGACCCGCACGTAACTGGTACCGACAGCTGAGTCGAACGCCGCGCGG
CAACTGGAAGAGCTTGTCTAAGAACTTCCAGACTCAATACTGCGGACGTGGCGTGTCTGTCGCGAGACAATACTACCATGCGCGAAAGCGATCGGATGAA
TCGCCGCTGGAATATCTGCACCGTCTGAATGTCGCCGGTCTGCGAGCTCAGCTCTCGATCAAGGATGGATCGATTGAGGTCCGCCGTGAACATGTCGATC
ACTTCATCGAAACACTCGACGATCGCGATCTAGCCAGCCAACTGACACTGCTAAGAATTCCGGACGCAGACACTCTCGAAGAGACACTGCGATCCCGACA
ACGTGCGAAGGCGAGACAAGGAAAGACGGTGTATGGGTCCATCAAACCCAAGCAGAAATCACCCACGGGGATCACCCCATCCGCGAATGCTCGCGCAGTC
CGCGCAACAGTCAACTCGAGCGACTCCGAATTGGAAACCAGCGGGTCGGAGGGAGAGGGAGACCTGCGCAAGGTATACTTCGCGGCAACGCCCGATCAGC
CGACCAGATCGCATTCGGATCAGGA