Description :
From Genome Similarity Track
Location :
Scaffold_125:18934- 25463
Transcript NameFunction/comments
Phyta_totarag4119hypothetical protein
Phyta_totarag4120hypothetical protein PHYSODRAFT_345496
Phyta_totarag4121hypothetical protein

Sequence
6529 bases(100 bases per row)
TGCTGGTGGACCCCTTTCTTGATGGCGTCCTTCCTGGCCTTCCACGTGCTCTCTCGGCCGCCCCGACGCATGGcgagctccagttcctgctccAGATCGT
TGTTGCGAGCGTCGAATCGCTCCAGTTCCGCCAACGCGATCCACTCGAACAGCGGCACAATGCTCAACGCACTCGGAGCCAAAAGTGTTACTCCCACTTG
CCGCGCGAATCTCACTGCGCTCTGCGGAGTTGGGAAGCACTGATACACGTGCACGACGATGGCCTCGATGCAGGTGGCCTCAGACGACTGAAGAGTGACG
CTGACGCACGCGAAGCGCTGGCCCGTGGCCTGCGGCAGGTCTGCAGCACTGAACTGGGCGTTGGTGGCCCCAACGTCGCCAGCTTCCACGCTCGGGAAGT
TTTCCAGTGCCATCGACATTTCGTCCTCTTTGTAAATAGCAAAGCGACTGCAGTCCTGACCGTCGGACTGCCCCGCAGTCTTCTCCACAGCGCAGATTTG
CCGGAATAGGTTGAGCGCGTCATCGATATCACGGAATTTGCCGAAGACGCGGAATCGAGTGAACTCCAGGTGGCCTGCTGCATTtagagctgcagctgct
ttACGAAGCTGGTCAGCTCTAGATTTTGCTGATTTGGACAGTTTGCCTGAAGACAATGACAAAGACATCCCCCTGGACGCAGGCCGAGCTGTCTGGTCCT
TCATGAACCCCAGGACAGCGAAAGGTTGACACACGCCGTGCACAGGGTCCCATATTGTAGCTGCGTTTGCTGTGACACTGGTGGAGGCTCCAGCTAGACC
AttcttgatggcgttgaGGACGTTGTCGGTCTTCTCCACACGGATACGTCCGCAACGACGCAAGTCGCTACGATGTTCCTTCGCGTTAAACTCCTCGCTT
GCTACTGCTTTGATTGGAGACACTGCAGGAAGCAACGCTCGGGTAATCTTCTCAATGGGGCTGTTTTCGCTCCCGTTCGCACGACGGCTTAGTGGTTCAC
TACTACCGGAATGAGCGAGTGAGAGTTGAGGCGTCTGCAACGTGGGTGTAGTGGACTCGTCCTGCGCTACAGGGGGCAACTTCGTCCGTTTTCCTCCTTT
CTCCAATTTCAATGCGAGTGCTGTCGTTGACGATGAACTtctctgcagcaacaaggaTCCAGAAGCGGATCGACTCACTTTTGTGTGCAAATTCAAATTA
TCCCTTTTGTCTTGAGGAAGTGACGAGCTTCGGCATTTGGAAAAATTCCCTCCAGGAGAGCTAGGCTGGTCGCCATTTTGAGTTTCTTCAGTTTCCTGTG
GACTATTACCACCATCGCGGTTGTCTTGCTGGGCTTCGTTGTAGCTTCCATCCGTTTGGTGCACTGCTCCAGATGCCACCATCTTAGTTACCACTCTACG
GCGCTCAAGCATGAGAGAGCCAGGATCAACCAGTGTACGAATGTCGTTAAGGGGCAGCAGTGGAGCAGATTGAGATTTTTCTAGCGTGGTACCTTGGTGA
ATGGAGATATCGGAACGACCTCCAAACGGTTGGTGATGATTTTCAGCCATGACGCGGGTGATGAAAGACTTCTTGTACTTCTCCCACGCTACAGATTTGA
GTGCACGACTCTGGATGGATTCGCGAATGTACCCGTTCGAGGAACGTTGTAGACTTCCCCGGGCCTCTGCTGACATGAGGTGGAAAATGTCAAACCGTGA
AAGCACAAGAATTTTTATCGGTGACTCCGCTAAGATGGAGTACTCGCGGACGAAAATGTCGTTGAATTTTCCTGCTGATGCCCTgtgaacagcagcgcaa
gtTAGCATCACATATCGGGGATTACATGCACGAGCGGGAGCACGAAAATATCTTACTCCGCGCAGCCCAAGACTGAGTTTGGGCCATATCTTCCCAGCTC
GTAGACTTGGCGCGCATTAGTGATAGGGTGTTTGCCTTCATGGATGATTCGGCACTCGCCTCGTGTTACGATGAAAAGCTCGCTTGCACGTGATCCCTAT
AAGCACCATAAATCCGTCAGCAGGCTGTAGCATGACAAAGTGCCACTTCTCGCAAGAAAATAGTGTTGCCAAGAGCCTACCTGCTTACAGATTTCGCCTT
TGTAGGGGATGTACTTTTCGGTCATAACCGAGCACATGCCTTCGATGGTGTTGTCGTCCCACTCGGGGCCAATGAAATACGGGTTCTTACGCAGCATCTG
CGCGTACTGTGCATGATACTCGTTCTGGTACTTCTTAATCAACGGCTCGTACTCGTCACGACCaagaacgagcagctcgcagaATTCAGTACACAACACT
GTGGCACGACGGACTCCATCAGCTTGGGAAAGTGCTAACTCTCCGAAGTACTCGCCCTCGCCGAGCCTTGACACGACACTGTCTTTTGTCTCCTCAAAGC
GATTCTTTGCACGGACAGATACGTCCACACATCCCGTGAAGATGATGTAGAAATGCCGCCCCACTTGACCTTCAGCAAAAAGTACGGTATTGGTGACAGC
ACTAATGAGCCGCATAACCTTGCAGAGCTGCTTTCGGACCTCGAAGGAGAATCGCGAGAAGAATTTGACGCTCTTCAGGTACTCGACGGCGAACTTCAAA
TCCTTTTCAGATCGCTGAGCGGAGCTTCGCATGAAAATATTGCGCACAATATCTTTGTTGCTGCGGAATCGCTTGGTTATCTCGAGCGTATTGGTATTAC
TGGAGTCATGTGactccttgagcagctcacTGAACACGACGCGGTTGATGAAGACCAGCTCCGCTGGGGCATTCGAAACAATCACGGATGCTAGGATACA
CGAACATATTAAAAATGACAACATCGTCCGATCAAACTAGACGAATAGAGTCTTACCTGAGCGTACGTCAGTATTGGACAGCAAAGCCCGCTCTCCAAAG
GTATCTCCTGGGCCCAAGAAGGTTAAATGAATTGTTCCATTGGGCCGAGCTGGATTGTTGACCTCATTTTTGACTATTTCCACTGCGCTtacaacagcat
cagcaaagTTTCCGGTTGAGGCTCCGAGAGTCTTTATGAGTTAAGAATGTTTCTACCAACCTCGGCCAGAGTAGACGAGATAGAAGCTATCACCATCGTC
ACCCTTTGTAAAAAGAGAAAGCACAACGGAGTCAGCGTTTGGGTCAGTAAAACTAAATACAAGGGAATACGCACCTCATGGAAAACATACACCCCCTTCT
CAGTGTACGCAACAATCTCGAGTGATTGATACAGTCGATCAAGCTGCCCCACACTCAGGATCAATTAGTTAAAGTGATTCACGGAGGCAGAAGTGAGACG
AAACGAACAGAACTCACCTTAACTGCAGGTAGGCAAGAGATACCAGAGGAAACGTAAAGTTAGTgcaggtccagcaccaaTCTTGCTCAGTTGTTTATTC
AATAACGGTACGAACATGCGTCTAGGTTGGAGAAGAATTCGAGTAGCTTGGACGACGCGAACAGCGACTTGAGCTGCACATTTGCGACAAAAATGAAGAC
CTTCCATAAGCTACAAATTCTAGAGCAGTAAGCGGGCAAACTCACCATGTGGATGTCCTCCAGTGTGCGCTTCCCCGTCGGTTTGTGCAGGATGGCACGG
CACACCTTCATCTGCGGACTCTTGTGCTCGATTATTCGCAGGAAGGCGCCGTCGCTGgtcatctcctccatctgcGAGGCCAGCGACCTCCGCCTGTTGG
GCGACGTGTCGCCATTcgcaacaactgcagcaacttcctcctcctcctcctccatggcgGCAGCTACCAGCAGAGGAAAAGCTGCTAACGTTATCAGCGA
CCACCAAGACGAAAATAAATGTGTcacaaatgtagccattttcCACTTCAACTATCGAATTACGTCAATTCGCTACAAATAAATAACTATTACTCACATA
AGTCATggcgaaggaggaggactcGTGGGTCGATGACGCCGtgcggcgtctgcgtcgcCACTTCACCAGCGACCGCTCGGTCTCTGTCTACGAGGCATTA
ACAGCCCACGTCTTAGACGCTGCCACAGGCGGCGTATTGTTCCTGGGCGGCGTGTCAGCGGCGCAGGTGGCACAGAAGCTTCTGCGCATCGGCTCGGCCT
CGGGCTTTTTGCTGCCTCAGACGCTGGGCGCTACCACCGtcgcgtcgtcctccgtcttggcgctgcacttcgccTCCATCCCGAGGGAAATCTAccagga
gctggcggcgcagaGCTGTCGATCCACTGAACAGCGAGGCTGGAGCTggctcgtgctcgtgctcggcGCCAGAAACCTGCAGCCGCCGACGGCGTGGACG
CAGGCTCAGAGAAAGGTGGAGGAGCGCTGGGAGGACCTCCCGCAGGCCCCATACCCGGTCTACATGGTCATGGGGCTACTgtgcttcaagctgctggggG
GCCGCATGTGTGCGCTGGCACCCTCGCCCTTCGCCAACCTCGGGGCTTTCCACctcaagaaggcgtcgcTCCCGGCGACGGCCGAGTACGCTACCAGTGT
GGAGAGAGGCATCGTCCAGGAGTTCGGACGGCTCTACGGCTGCCACACGTGCGGAGTCAAACGAGGCGTACGATACCACGCAGACCACATGCCACCCAAA
CTGTAGGCAGCAGTTGATGTTGGCAGATATTGTGGAGTTGGTTTCTTTTGCCGTCTCGGTCCTGACTTGTTGTGCGGGTTGTTGCCTTGCTGACGTATAG
GGTGGCCAAGCGGACAGAtgagcagctcttccggAGGATACTGGGCCGGAAAACGACGTTCCGCTTTTACCCGCAGTGCGAGCCGTGCTCGAACCAGCAG
GGAAGCGTGGTGAAGCAGTGGAAATCGACGCTCAAGATGCACATGCTGTCATTCCGAGCGTACCATTCTACTGGCCTGTGGCTTGTACTGCTCTGCACTG
GCGGCCTCTATGTCGGAGGCTCAAACTTCCATGAGACGTCCGAGGTGTCTGCTCCGATGGATGACGTTTATGAGACCCCCGGTGCATTTACGTCGTCCGA
TTTTGCGCTGCTAGTTTCACTACGCGAGCGGGAACGGAAACTGCGCCGTGAACGAGGTAAACAGAGCGATCCGAGTCAGATCGCTGCGATTGATAAAGAG
TTGGAGGCAGTAGCGGAGTGCAAGATGGCCGTCAAAGCCGACATCAAACGGCAGAAGGCGAACTAGCCATGAGTGTAATCAGCCATTAACACGCACTCAA
CGAGCGATTGATTTGTGAGCAGTGCCAAGGAGTTTCGTCTCAAGCTATTTCCGTTAAGTGACGCCgttcgacaaggagaacTCTTGAACGCACGTCGCCA
CAGCTTATCGTCAATTGGGCCATGTCGACAGTCGAGCGAGAGTCTCTGGTAAAGAACTGTCTCGACCAACACCACCCAAGGAAGCTTGGAGCACGCAAAC
CGAATCATCCCCTGCGAGGTCATCGCCATCTTGTTACGCTTTCGGAGGAGGAATTATCTCGACGAGAGCATGGATGGAACGATCGCTTTTCTGTCGATCC
TCCGCCCAAATCCAATAAAGCTCAGTCGCCGGCCCATTCTCCGACGTTCAGCACCCCGCCGACACCGCTAACGAAGGAGTCCAGGATTCACAGCGAACGC
GCACAATATGGTACGATGAAGGCTTTCAAACAAGTGTTTTGGGCCGCTTCTCATTAACAAATCAAATACCAGGCAAACGTGGTGGAAAGCGGAATCGTGA
GCCAAAAAAAACATCAAGCGGGAAGTTGGCACCTCTGGGTACTCTGCCAAAGCTCCCTTCGGTAAGCCGCCTCTCCAGTCTTCTTCGAGTTGATAAATTG
ATAGTGTACATTGTTGAAACAGGAAGCTGCACAGTCCaccaaagaagaaaaacTGCGCTTTAAGGTTCTGAAAGCGATCGACGCCCGCGAGACCCTGCTG
TATCAGTTAAGCGCTCTTATTCTCTGCACACCCACGCAAGAATCTCTGTTCCTCCCGGCACGACCAACCGGGCCTCCAACATCAACCAGTGCAGGTCGGC
AACAAATGCGATCAAGGGGAGGAATGACACTCGCATCCAATCCATTGAGCCGTCATGGGGGGAACCCTGGTGTGATGACAAATACGCGCGAAGCTACGAA
GCTAGCGCAGCAACTCGCCACAGATCTGCAGGTTACTGGAATTCAGTGCGTCGAAGCATTGGTCGAATGGATGCTTGAGGCTGGGGCGCAGGCAGAGTAC
GTACACCTGATGTGCCACTTACTGATATTTGCCACAATGCTAACATAATATTGGCGTGTCTAGAACCCCTCCGCCGTTCCTGTGGCGCGGACGAAACTAC
TTCCTGAAGATGGTCAGTGATCTGGATTTCGCAGAATCGGAGTTACAGGCAAGAGGAGTCAATTTGGACTGCTTCAAGCAACACAACCCCCTGCTCGTCA
AGCCGAACCAAAAGCTAGGTCGCGTGCTGGCTGCCCATTCTATCATCATGGAAATGGTCGAGTTCGCAAAAGACATGAGTCCGAGGGAGCTGCTTGCACT
TAGTGGGCGAATGCGCGAGGAAACAGAGA