Description :
From Genome Similarity Track
Location :
contig_28:189308- 191360
Transcript NameFunction/comments
g6618.t1hypothetical protein

Sequence
2052 bases(100 bases per row)
CGGCGTCCCAGCTTTTCAGACGTGATCGAGCGTGGCCTCTCATCGTCAGATGCGGACGAATCTCCGCGTCCAAAGACGTCCTCGTGGTCGTCGCCGACCT
CGACGGCCACGCGTGCCTTCGGAGGACTCCGCTGGGTCAGAGTCTGTGGTCGCAGCTGTCCTGATGAGAGATGGCGATGACCACCTCACGCGCGTTCGTG
ACGTTGAAGTCGCACGCCCTCCGTGCGACGCGGCGAGCATCACACGTCTCTCCAGTGTGTCGTGGAAACGTTTCCTTCACGACCTGAAGAGCTGTGAGAC
CGAGCAAGTTTGCATGCTCGTCGCGGAAGACCCCCCGACTGTCGCAGCCGTCACTGCTGATTCCTACGACTGCTCGCACGCGAAGCGCGCTGCGCTGCTC
AATCGTTACCGGCGCTTGAGGCGGTCGGCAATCCTGTTACTACGCTCGTTCATGAATTCATTGACATCTTCCCGGATAAAGTCCCCGCTGCTCTTCCCCC
TAACCGTGGAGTTCGGCACGAGATTGACCTCGTGTCCGGCGCGAAGTACTGTGTGACACGACAATGGCCACTTTCCCGAGACCAATGCGAAGCGATCGAT
GCCTTCTTCGTGGGTCGCCGACAAGCCGGCCGCGTTCGTAAAAGTATCTCCCCGCATTCCAGCCCGACGTTCTGTGTGAAGAAGGCTACTGGCGGATCCT
TCACACCTTTAACAAGCTCAACGATGCCACCACCCCGGCGCAGACGTCAATTCCGCGAAAAGACATGGTGCTCGACACCACGTCTAGCAGCACCTCATAC
AGAACTATCGAGTTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGACGACGTGCCGTTGACAGCTGTCAGCACGCATAGTGGAATGCTGCGGGAAT
GGCTTGTAATGCTGCAGGGACTCAAGAACGCTCCGGCTACCTTCAACCGGATGGTCTCCAACTTGCTGCGGTCTTTCCGTGACTTTGCGTCTAGCTACTT
CGATGTATCTTTATCCTCAGTCATGCCGCGCGGCATGATTGATGTGCACCTGGATCACCTCCGCCAAGTGTTCGAAGTGATGCGAGACAACAAGCTGTAC
CCCAACCTGAAGAAGTGTATCTTTTGCGCTCCCGAAATCCCGGTGCTCGGGAGCTACGTCAGCAAGGAAGGTGTCCGTGCTGACCTGGAGAAGATCGAGG
TCACTTGTGCATGGCCTCCACCCCAACACCAGAAGCAGTTTCGCCAATGGCTCGATCTCGCGACGTATCTCCATTATTTCTCGAAGAACTTCGCACTGAT
TGTTCGTCCACTATCTCAACTGCTCAAGGCAGATGCCACGTGATCATGGCGACTCGAGCACCAGATGGCATTCGACGCGGTCAAGACAAGCCTCTCCACA
TCGCCCTTCCTGATGCTTTCTTATCACACGAAGCCTTTCCACGTGGTGTGTGATGCGAGCGACTTCGCCATCGGCTGCGCCCTGATGCAGTTCAACGACG
AGGGACGCGAACGAGGGGTGAGTTAGTTACCAGTTGCGTCAGTTGAAGCCAGTGGAGAGAAATTATCCCGTCCACGACAAGGAGCTGCTACTGTAGCAAT
GCGCTACACGCTCATCCAGTTCCGAGTATACCTTCTCAGCGAACAGACATTCGCTATTTTCAGTGACCATGCGTTGCTGAGGACAGCGATGAAGAGTCCC
CTCTAAGTCAACACATAGCACGTTGGTTCTTGCTGTTCTACGAGTACGCTTCGTCGTGCACTACAAGCCGGGCCAGATGAACATACTCATTGACGCACTC
TCGCGTTGACCTGATTACGCGCAATCAGGTCGCCACGCGGTTGGCGACGAGGATGACGATGAATGTGCCGTGTGTGTATCTGACGAGTTCGCTGCCGTCG
AGGTCGCAGCGACTAGTCCGCTCCCTGACGTGATTATATCCGCGTACGAGTCGGACGCGACATGCTCCGAGATGATCAAATACCTGTGAGCCCTGTCCGA
CGCGGCACGATGTCTACTGTCTCCGCGTAGCCGCGCACTTATCGATCGATAC