Description :
From Genome Similarity Track
Location :
Scaffold_499:1893- 3596
Transcript NameFunction/comments
Phyci_110934Hypothetical protein

Sequence
1703 bases(100 bases per row)
ATAGAGAGCCACTTCGAGCGCGTGCTGGCTGCTGACGCCGATGCCGACGCCGCGCCCAAGCGCGCGGCTGCGTCTCCCCCCGCGGCCCCCGCGGCAAAGC
GCTTGCGAGTGAGCGGCGCCGACATCTCGGCGCTCGTGGACGGCGCCGAGGCGCAGGAGGGCGACGCGCTGGACGCCCGCGCGCTCAAGTCCATGGCCAA
CGCGCTGCAGAAGCGCGTGCGCCGCAACGCGCTGGCGCGCGAGAAGCACGCGGCCGAGCCCAGCAAGTTCCTGGAGTCGGAGCTGGCGCTGGACGCTGAG
GTCGCGCGCTGGCGGCAGCTGGCCGCCAAGCCCGAGCTGTTCGCCGCCATGACGGAGCTGCAGGTGCCCCGCGCGCTGCTGGGGTTGCTGGGCCACGCCA
ACCTGGACGTCCGCCTGGCCGTGCTGGGGCTGCTGGCCGAGCTCACGGACGTGGACGACGCCGCCGAGTCGCTGGAGCCGGCGGCGCAGCTCGCCGCGCA
CCTGGTGGACGAGAAGCTGCTGCCGCTACTGGTGGCCAACCTGTACGAGCTGGCCGCGGCCGCGGACGCCAGCGAAGCGGCGGACGAGGAGGCCGCGGGC
ATCTACCACTCACTGCAGATCCTGGAGAACCTGGCGGACCTGCGGCCACCCGTGTGCGCCGAAGTGGCAGAGCACACGGCCGTCCTGCCCTTCCTGCTGC
AGCAGCTGGGCCCGCGCAGGGGCTTCAGCCAGAACAAGCTCTACGCGAGCGAGATCCTGTCCATCCTCCTGCAGGCCGGCAAGGAGCCAAGGGACAAGTT
CGTGGCCTGGAGGGGGCAGGAGCGCCCCAAGGAGGAGTAGAGGGAGGGCAAGGACAAGGACAAGAAGGTGGATCTGATGGACGACTTGTTACAGGCGCTG
GCGCCCTACAGGAAGAGAGACCCCGCCACAGATGAAGAAGAGGAGCTCGTGGGGAATCTGGTGAACGCGCTGTGCAGCGTCCTGCTGGTGCCCGAGGCGC
AGAAGCAGTTCCGCAGGCTGGAAGGCCTGGAGCTGCTGCTGCGCTTTGTGAAGGACCGCCAGCGATTCGTGTTTGGAGGGGCGTTGCGTGTAATGGACCA
TGCGCTTATGGGCAATGCGCGGAACTGCGAACGGTTGATTGAGATCGGCGGTCTACGAAGCGTGTTCTCGGTGTTCATGGGTCGTCATGGCAAGTACAAG
TTAGCAAGCGCTACGAAGGCGAGCAAGGCTAGTGACCGCGCAAAGGAAGAGGAGAACGCGGTCAGCTTGGTGACGTCGATGTGTGCGTGGGTGGGAGAAA
AGGCTCCGGCTGATGGCTATGACCGGCTGCACGCTAAGTTTGTGGAAAACGAATTGGAAAAAGTTGATAGATTAGTGGATTTGTTTGCGAAGTATCACGA
GCGTGTGGGTCACAGCAATACGGACGACGACGAAGACGAAGATGAAGACAGTAGGTATCTGCGCCGCCTTGATGCTGGTTTGTTTGTTCTGGAGAGAATG
GCATTTGTGGTTGCACATCTGTGCCGCTTTTCGAAGAAGTTGAAAGCCTACGTGATGATTAAGTTCCACGAGCGGAGTATCGAAAGCAATAGTTTGACCA
CTATCTTGCGCGAGCAATTAGACCTCTTTAAATCAGAAGAGAAGGATGATGATGAGGTGGATGAAGCTAGACAGTCCCAGAAGGCACAGCTTCGCGCGTT
GCT