Description :
From Genome Similarity Track
Location :
Scaffold_172:1893- 3381
Transcript NameFunction/comments
Phypl_g4671hypothetical protein

Sequence
1488 bases(100 bases per row)
CACGACTACACCATTGCCGTCCATTTAGCTGGGGTTGATCCGCACGTGCATCTCAATGTGCCCCCCTTCAGATGATCGTGGAACCCAGAGCAAGAGGGAC
CCGCCACCCGAACCAGGTAAACCTAGAATCCCCGGGCGCCAGCGATCGAGATACAAGGtcttgtcctgcagctctgGGATCGTAGCGTCCCACGTCACCG
tctcgccagcgccaacttTCACCTCGGCGTATTTGTCTCCACCCGAATGAACCACCACCTTCACGTCGTAGATATCCACGCTCTCGAAGATAAGgtgcac
gacgccgtctccCGCCTTCGTCCAGGTACCATAACTTCCAGTGAATGCTTCATCCACTGTCGTGAGACCGAGTGCATCGGAGAGTCTACCATCGTCGATC
TCGCCGAGATAAGCCGTTGGTCCACAGATGGGCTGTACGAATTGAGACGCCATGTACGCGATGCCAGTGGGATCGATCGTAGACAGCACGACGAGGCCCA
TGTTGGCCACCTTAAGCATGTAGTCGTCCTTAGCCACGTCCTTCCCCATGTCCGTCGTTCCAGTATCAATGAGCTGGTCGACAATGACCCCAAACGTCTT
CCGGAGCATATCGCGCGTCTCGAAGGCAGCCGTCAGCGTCTTATTGCCTAGGAGCTCCCCCATGCACAAATTGGTGACGGCCGGGATGTCGTTCATCACG
ATTGAAGACTTGTACACCTTGACGCGAACGTCGTCAGCCGATGCGTCAGGTGTTGAGTTGCGTGCATCGTTCACCTGGCGCACGACGTGATCGGTAaggc
gcttgagctcgtagCCGCACGTGGAATTGGTGTTGGTCAAGTTTTGAAGGTCGTCAACCGTTGTGTTCTCTGTGCCGTTGAGCGCCCCCGTGCCGGTCAG
TAGCTTAAGCACGTTCTCTCCTGTTGAGATGATTTCGTCACCGTTTGTGATGGCCTGCTTCACGATCCCTTCGACAATTACCAGGACCGTGTCAGCAAAT
TGGGCATTCTTGGGCACAGGTAAGCCCAGGCAAGCGCAGACGGCCACAGGCAGGTCGTATACGACGACATCTGTCTGGTAAGCTGCAGTGAGCACTTCTG
CTGTCGTTCCTTCCGGTGCCGTGGTTTGTCGATATCGAAGGTAGTAGATGAGACCTCGAACCACGTTGACAACGTTTGCAGCGCAGGTAACAGCCCACTT
TGCCGTCTTGTACGCTGCTAGAATGTCTCCAAACACACCTCCGGTAGCTGCGTTGAGCGCCACAGCAACGACAGATCCGATCTTGGAGAGAGCTTCAAGT
ACACAGTCGTCGTTTTGAGGGATGCACTCCAACGAGCACTGGACTGGGTACGACAGGGGGCACTGCGCTTGGCAATTGGCGTCTTCCTTCCCGTAGCCCA
ACGGACAaatgttgttgctgtcgaaATCCACTGATTTGCGGTAGCACGCGGTGTCGCTCGCCTGTCCGATGGTGGGCCCCACCCAGTT