Description :
From Genome Similarity Track
Location :
Scaffold_64:189253- 191107
Transcript NameFunction/comments
Sapdi_VS20SDRG_13908hypothetical protein
Sapdi_VS20SDRG_13909hypothetical protein
Sapdi_VS20SDRG_13910hypothetical protein

Sequence
1854 bases(100 bases per row)
CACGCGTGCAGCCTCCTTCTGTAGCCGCTCCGTGTCGGCGCGCAGCTTGCAAAAGATGGCTGACGTCGATGGCACCTCTTCGTAGCTCAAGCCTGCCTGG
TGCAAGCGGTGCAGAATGTCTTGCTTCGTCAGCGACCCGATCGCCGGCGGCTCGTGCGGGAAGGCCATCACATAGTCGTAGTCCTCGTCGTCGCAGGTCA
CGGGCAGCGCTTCATGCGAGCCGTAGCTTGATGGGGGCGTCGGCTCTTCGCTCGGCTCGGGGGGCACGAGCGGCTCGCGCTCCTCCCGCGTCGACGACGA
CGACGTGCTTGCGGACGTCGGCGATTTCCGCGCTTCCATTGCCGTCAAGTCAGTCACTGACAACACAATCCCACCGATTTCTCTTGGATTCAGTATACTC
GGCCCTTCATTCGATCCGGATACGACGGGAAATAGTGTACTCTTGAACGCATCGTGGGACATGCAGCCGCGCCGAGTTCGGCCCCCGTCTTTCGCAGCCC
AGGAAGCGCTGCGGCAGATGCGGCGGCCGCGTGCTTTGTCCGGCGTCCGCGGGCTAACGGTGCAGCGATGCACAGGTCGGGCGAGAATTGTAACGAAAAT
AGTGTAAAGATACCGGGTGATAGGCGGTGTGCAGAGAAGAGAGCAAGCTCTTGCACGTTGGCCGCAAAGATCGGCGCGGGCTCAACTCGTCGAAGAAGCA
TCTCCCACCGCTGCATGCCGGTGCGCACCCGCGCGTGCGACGCGAGACGACCAGCTGCCTTTGCACGGAAATAGTGTATTTCAGGACATGTCCGAATTGA
AGCTACACGACCGAATTTGGCCTCAGTTTGCCTTTTTGACATTGCCCGAAGAAGCGTCCCGATGGCCGACCGCCCGCCGACCGTGCTGCCGCCGCCGCAG
CATCTCGGTAGCAAGAGCGACTTTGACGACATTGAAGGTAGCATCCCAGATGTGATCGAAGTCCCATCTCGAATCATAGATCTGATTGAGCGCAACAAGT
GTGCGAAAGAGTACTACAAGCTCGAGGACTGCCTCGCCGAGTACGACCGCAACTGGTCCAAGTGCCAAGCCGTCGTCAAGCTCTTGCGCGAGTGCAACGA
GACGCGCAACAAGAAGAAGCACTAGTCGCTTATATAGTCGAATTCCCGTCGTCTCTATGGTTGTATGTGGTTTCTAAAACGGCGCTTCGGCCGATGTCCG
CGCTTCGGTGCTGCCCATGACGTCGACGTCGTCGTCGCTGCCGTACCAGCCGTCCATCGTGTCGATCTCCATGGCCGTGTCGTTCTCGCGGCCTTCTTCT
TCCATTGCGAGTCGCGCGTACTCGGCGCGCGCGTACCGGTCCCAGTCGGTGAGCTCAGGCTCGGCCATTTGCTGCCGCAGAAGAAACGGGTCCCGCTGCT
CAAACTCGATAAACTTGCTCAAATTGAAGAGCACGTTGAAGAAGACGCCCGAGAGCCGAATCTTGTCCGGCCGCGTAAAGTCCGTAAAGCGAAAGTCGCC
TTCGATAGCCGGGTGCAGCAGGTCCGACCTACGCTCCTCCAAATCAGCTCCAGTGCTTCTAGCCGCCACGTACATTTGGCACATAATGTCTTCAAAGGGC
ACGACTTCCTGGCCCAAGCACTCCATGCGGTGGATCTGGTGGTCGTAGTACACGCGCATCTCGTCGGCGCGAATGACGTTGTCGCCAATGATGTCGATGA
GCTCAAACCAGTAGCGCAAGCTCACGGGGTTGCCCTTGTCTTCTTCCGAGAGCATGAAATCTAGTCATGCAGTCATGAGCCCCATGCAAGTCGAATGCAA
GCGGCGCACAAATGAAGTCTTCGTAGCTCAGCTTTTGCTTCTCGTCCGGCGACA