Description :
From Genome Similarity Track
Location :
Scaffold_14:189225- 193048
Transcript NameFunction/comments
g1193.t1ETL28106.1 hypothetical protein L916_18472 [Phytophthora parasitica
g1194.t1XP_008897019.1 hypothetical protein PPTG_05258 [Phytophthora parasitica INRA-310
g1195.t1RAW42921.1 Dynein heavy chain, cytoplasmic [Phytophthora cactorum

Sequence
3823 bases(100 bases per row)
ATGTGTGGGAACGACCGCTTGTGGAGCGGCTGCGGGCTATGACGGAAACTATCAAACAATCTGGCACTAATGCTTCCGTGTCTGAGGAGTTGCTAATCTG
GAAGGAGCAGGAGCTGTTGGTGCGTAGAACGTTAGCGGAGCTTGGAATGGGCATGGAGGTTTTCGAAACCGAAGCTACGCAAAGCGAAGGTAGTTCTTCT
GGCGTTGAAAGTGGCAACACTAGCGCGGTCGAGAGCCACTACAGAACCATTCGCGTCACGACGCTCGGTCGATGAGGCAGCACATTAGAGATTCTAGCAA
TCGTCACACGAAGCGTTTGTGCTACTACCAGCGAAAGCTCATGGGTCAACATCAACACGTAGTTACTTCAGTTGCATATTCTATAAACTTCCGACAAAAC
GCTGCCCATTCCAAAGGTGCATGCTGCCTGTTTCGCATTTGTCGAGTACCCTAACGGCGCTTCAACAGCTCAAAGACCAATTCAACGTTGGTTCGGCCCA
TTTCTTCAAAGGCATCGGTCTTCGTCACGGCGTCAAAGTTATGAAGCATGAAGGCGACACACTGGTCTCGCAGTACTGTCGCGTTGTGGAGGTCTGCAGC
ATGGAAAATACTGGCCGCATTATCGATGCACAGGGACCCGAGCATTTTACTTTCGCAAATGCGCTTTAAACGTTCAACGCCATACTGATTTAAGAACATA
CGGATAGATGTTAGCATAAATGAAACTCACAACTGTGCAAAGCGGCATCGCGTACCCGGTCTGCAGTGACGAACAGCTCCATCGCAACGTCCACAGCGAC
ATCCAGATAGTCTGTGTACAGATACTCCATCAAGGAAATAAAGATCGGCCGACGCACATCCGTGATTTGAATCTCGCGAGCACGGCTTTCCAGCATCTCG
CCGGTAAGCATCGCGTTGAAATAGTTGCAGCGGATGCACAGAATTTTGTGCCCGTACACAGGAATCCCCTCCACTACTCAATCACAGTAGCAATTTGTGG
GAGCTAAGTTAGACTGCACCGAAATCGTCGAACAAGAGGTATTTCATCGTACGTACCGACAAACGTTACATCACTCATGATGTCATTGTTTACCAGAATC
CTGAGATCGCTGATCAGCGTGCTCTCAGGAATATCCAGCTGAAACTCCTCCTCTCCAAAACGGAATTGCTTAAAGTCGTTCAGTCGACTGCTTCCATCGT
AGCCACCGAAAATGATCAGATTGGCGTCGTAAACAGTACCAACGTGGCAGAATCGTTGTCCTGGTGGCTGGCCATTGAACTGCATTGGCTGCCACGTATT
CGATTCTAGTTCATCAACAGTACATAGTCACTGTCAGCACGAGAACGATTGACGAGAGATCAAGGCGGCAAATTTACACAGACGAATCAAAAATCTTAGC
TTGCTCACCCAGATTCAGCTCATAGAAATCATTCACTGCAGTTCCCGTACTGCCACCAAAGATATACATGGCATCCGAGTGGATCACCGCAACGTGGCTG
TCGCGAGCAATCGGCGCTGGGCCTTCCGTTTGAAGGAGCGACCACACATGCGTATCTAACATTGGAATCACAATGTCAGCCAACAAATGATGCAGTATTC
GACGCGATTCGTATTCAATGAACGTACCAAAGTCATATACATGAGCATCGTTGAGGTGGCGCGAACCATCGTGTCCACCAAACAGCACACAGGTGTGGTT
ATGCACTACCAGCGAGGACCGATATCTGCGAGCACCATTAGACAGCATTTACCATAATACAAAAAAGTCCGAGCTTACCGAGGTCTTGGAACACGACCCG
TTGCTGCTACTAATGACCAAGTGTTTGTTTCTAAGCAAAGCAGTGATAAACTGTTGTTAACAATGGTGTAGCGTGGCATCTTTAACCCAAAACAAATATC
ATACGCAACCCAACATACCGAAGTTGAATTCGTGGAAATCGTTTCGGTAGCTGCCGTCGTACCCTCCGAAGCAGTACATGGACTTGTCTGTCACATTCAC
CATACCAATGCGTAAATATGCCAGATCAATACGCAGAGCTTTCTACCGAACAAGCAGCGCAAGCGTACCATACACCACTGCTGCATGGCTGTGTCGCGCT
GTCGGAGGCAGCCCGGCATTCACCACAACACTGCTCCACCTCTGCGTCACTGCACGCAGTTGACACCCACACAATAGTCAACAACTAAACACACAAATTC
CCACAGGTCCGATAGTTCATGTCCCCAACGTACGAAAGTTATACTCGATGAAGTCGTTGACACGGGAGCTGCCGTCGAAGCCAGCAAACACGTAGAACAA
ATCTTTGTAGACCACTGCCACGTGACGGTCGCGCGGACTCGGGGCAGAGCCGATGGCGAGCACCACCGACCAGAGCTTGCGCTTGAAGTTGAATTCGTAG
AAGTCGTTGATGCGGTTCGACCCGTCGTAGCCTGCACACGCAGTAGCCAGCAAGACAATCAGTAATTTAGTGAGCGCCACCGTCAGGAAGTACCAACACT
CGAGATCGCATATTGTCTACAATCGCTCCACACAAAATGGTTGCCTCGTCGTATAAAGGACTACATTTTTGGTCACGCACCTCCGAAGATGTAGAGCGAG
TCCTTACGGACGGCGCACACGTGCAGCGAGCGGTGGCACGGCGCCGCCGACGGGTTCTCGCACGGCACGTTGATCCACGCGCGCGAGCTGGACTGCAGCG
CCATCACGAGAAGAGGAGGACACCGGGAAGTGCTCCGCAGCGAACTGCTGGATCGCTGCTGTGAAACGCCAGAGTCTCTGATTTGCTGAAATAATTTCTT
TTCGACGAATCGCGCTCGGAACTGAAACACCTCCGAGGTTTTTCTCCCCAGGTTGAAAAATCTATGAAAATCCTCGCATTTCGAAATTGTACCGCTTCGC
AATATGGTGGGTGATGACGCTTGGCAATGAGGCTGGAAGTGACGTGTGGCTCTAACAGGGGTCGTGTGTACAGTCAGGCATCGGCGGAAAAGGCGGAAAG
GGAGGCAAAGGCGGCAAGGGCGTCACCTCCAAGAGGGCGCCGCAGTCGCGTTCACAGCGTGCCGGACTGCAGGTAAATCGATAAGCGGAATGTTCTTGCC
CTTTTGGGTTGCTCACCCTCTGTTCTTGTGCTGTGTGTCCAGTTCCCCGTGGGTCGTATCCACCGCTTTCTGAAGAAGCGCGTGGCCAACAACCAGCGCG
TGGGCGCGACGGCGGCTGTGTACGCTGCCGCCATCATGGAGTACCTGACGGCCGAGGTGCTGGAGCTGGCGGGCAACGCGTCCAAGGACCTCAAGGTCAA
GCGCATCACGCCGCGCCATCTACAGCTCGCCATCCGCGGAGACGAGGAGCTGGATACGCTGATCAAGGCCACCATCGCCGGTGGAGGCGTCATCCCGCAC
ATCCACAAGAACCTCATCACTAAACAGAACAAGAAGCGGATGCCTCTGTAGAGACGAAGAGACCTATTGCTGCAGTTCTACAGTCAGTGGCCCGAGGCTT
TTCCTCTCTCTGCGGTCTTTGCAATGCATATATAACTAAAATATGAGTTTTGTTGGCTCCCCCGCATGCAGAAGCTGCCGTCGCATCCAGCCCCATTTTC
CCGCCTTTCCGACACAAAAACCGAGTGAGAACGCAAATGATTGCTACAGATTGAGGTGGTGGACGCCAACCCCTCAATAGCGATCCACGTGCACTCCCCC
CCCGCCCCGAAGAAGATCGACGGGAAAGGAAACTTGGTTGACTGCACCGAGGCGAGTGCGCGCGCTGAGGGCCGAAAGTTGCCCTTGGCCATACAAAGAC
CAAGCCAACAAGAAGAAACACAG