Description :
From Genome Similarity Track
Location :
Scaffold_117:18920- 21160
Transcript NameFunction/comments
Phymu_g4730hypothetical protein PHYSODRAFT_389386
Phymu_g4731hypothetical protein PHYSODRAFT_389386

Sequence
2240 bases(100 bases per row)
CTGTCCCGTTCCTTGTCCGATCGCTGGAAAACGGAgcgtcgatgctgcagtAACcacgccagcttcttcatttGACCACAATACACGTAATTCGTGGCTG
AAAGGAGGAAATTCGCGACTACGGACGTCAAGATAAAGCGAATTGCGTCACCGCCAGGGTCCACTGTAGCACACGAGAAGTTCCCGATCATATTGGGGCC
AATTTGTCGGAAACAGCTAAAAGCCGACAAATTTCCGCGGATTTTGTTCGGAAGCGGCCCCGTTTTCGGGAAATCAACGGAATGTAAGAAGTGGTAGCCC
ACACACTCGCCGTCTTCGTATTCCACGACTCCTGTCGCCtcaatgaagacgaagtcgcGGCTCTTGACTAGCTTTGTGGACTGCAGTGGGGGGTCAATTG
ACATCCACTTGATCACCAACGACTGGAAAGGCTCCTCTTTGCTTGGCTCCACTATAGAGCACAGTACAGCAGCGTTGTCGAAGTCTTGGACGTACGAAGC
CTTGATCCGCATTGAATCCAGCGTAGGGTTTACCACGCCAAACATTAGGTCTTCCAGCTCCCCAGCGAATGTACCAACACCCAACAGTACGGACAGATCC
TTGACGGATGAATTGTATCGCTGACTTGTGCCTCGAGAACTCCTCACTGATGAGCGTCTTCTACTGACCCCTCTGGGGGTGCGCTTAGCGTACACGTGGA
GCTTATCACGAGACTTGACGTGTTGCCATCGTTGTGTATTGACCTTGCACTGGTCGTTGACGACGAAACTCTTGTACTTGTCGATGTAATCCTCCACGTA
GTTATCCACAAGGTCGATCATCTCCTGTCGATCGGTGCTCGATACACGCAGCTCTGGGAACGGAGTGATGGTAAAGCCGCCCTTCATAGTGTCGGTGAAA
TGGTGAATGAGGTTGACGGGCCGCCGCCCTTGGACCGAATTGACTGAATTGACTGAATACGGGCAGCAGATGCTGTAGGCCTGGCAAGCGTTTAATGTGA
CGTGGCGAATATAACGCACGGCAAGCATGCAGACCTTATTTTGCCAGACAGTTTGTCCTTTGCGCTGGTTCTGGTAATTATATGATGAACAGGTCAAAAG
CGCCCTTACAGTGCTTTGTTTACCACCGCCGTCGACTTTACCTTATCCGCTCCGTACAGATGGTCGTAAGTCTTTAATTTGTGGTTCAACACTGTGTTGG
GCATCTGGATCTCCACATCGTCTTGAATAGAGTAAGCAGTTGACATCTTTTGCAGTCTCTACGTGTTTAGATACATGGCTACTGAAGTACTTGGTCCTCT
ACTGTAAAGCTTCTTCGAGCACCAGACCATAAACACATCGACATTCTCCAGCATCTATCATGCACTTTGCTCTAAAAACGACTATTTGCCCTCCCTGGAG
ACTCTCGTCACCTGTAGTAGCGTCCTTGACCACCATGTGCTGGTGAGGCTAAGATCTGATGGGGCCATCATCCGTAGATAAGGTCGTTCTACCTGTGTGG
CCTCTAGAACACAGGGTCGATTCGGTGGTCGATAACCAACCCAAACGTAAAGCAGTGTAAGCACCTGTGGGTTCTTTTTCCACTCGTGAGTGGCTTGCAG
GTGCCACGTAGTCGCATCTGTTGATAACTTGAAGATTTTCctttgaagcagctcaatgcCAGTGTCAATTTTGCGTCCGATGCCAAAGCCACGTGTGGTC
TCCAGTCCATTCCCCGACGTTTGGGTATCAGAAGCTGAACGTCGTCAGCTCATTGACCTCGTGGACTTTTACGTTGACGACTACGTCCAGAAATATCAAG
ATTTCGTCAAGATCGACAAGCGCAGAGTGAACAAGCGACGCTGGGAGCACGTCAAATCCAAAGGAAACCTTCATGTGTACGCTGAGCGCACTAAGCAACA
GCTCAATCGACGGGGAACCACACTTGAAAACTCTCTCAGCACCACCCAGCGACTAAACGTCAGTGCCAATTCCAAGGATTTAGCTGTACTATTGAGTGCA
GGGACGATCCCTGGCGAGTTAGAGGACCTCATGTTCGGCGTTTTGGCTCCAACACCAgacgagatgaagatcaagTCCTCGACCATGTACGACTTCGATA
CCGCTGCGATGTTGTGTTCAGTATTGAAGCCCAGCAAGATCGACCCGTACCGGTCCCTCGCCATCAAGTGGATGTCAATCGAAGCCCCGATAAAGGCCAC
TAAAAGCCGTGATTTCGTGTTTCTCGAGGCCACTGGCGTG