Description :
From Genome Similarity Track
Location :
Scaffold_234:1892- 3936
Sequence
2044 bases(100 bases per row)
TCGATCTGATGTTATAGCTCGGCCTGCACCAGTATCAACCACCCACATATCATCGGTCAGTTTAAACTTCTTCAAGGCTCTCAAATAGGAGTGATGCTGC
TTACGTACCTCCTCTTCGATGTCGTCCATTTGTAGTGGGGACCTGACAGGGGTATTCGGCACGTTGCCACCATCCTCAAAAACTTTATGGTAGGCGGTCC
AGATCCTCAATGTCGTCCATCTCCTCGTCCTCAATGCACTCTTCCAGAAGAGTCTTCCCACACTCATTTAAGCGTATTTCCCCTTCTAGCACCACCGATT
TGAGAAAATTAATCGGGGTTGTCTTCGCCTTCTTGGCCTTCTTAGCACCCGATGCAGTGTTGATATCGGTCCTAAAAAGGGGTCCACCTTCGCGGTTAGG
ATCCCTATCAGCGATCATCACCGAACAGTCCGATTTAAAGTGTCCACTCTTGAGGCAGTAAAAACACCTTTTTCCACCCTCACCTGCACCGCTTTTTCTC
TTGACCCCGACATTGTTGACAGGAATCGCTTAAGTTTTATCCATTAAACCCACTTCTTTCTTGGATCGGTCACCAAAGGTCTTGCGTAAGTCCACTTCGA
CCCTATCCACCGTGAAGTCCTCTTTCTTCATGGAGATCGCTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTAATAAAATTAAGTCAGAAATAGGACTCGATGTCCAAATTAGGACAGCATTACTAGAAATAAGA
TAAAAGTGTGTCCGAAAACTCGTGTCGCAGCCCATTTTTTAGTTCCTTGTATGCCAGCCTTACTAAGTGTCACATGCCATTATCGGAATGGCTAAACAAT
ATCTAAATAGCACGTCTCAACTCGTTCTAGAAACCAAGCTATAGATAGAAAGGTGAGTGTCCGAAATATTTTGTCGCGCAGTGTAGATCACGCGATACAA
GAGGTCGCTGGGGCTGTAGACGAAGGGATTGGGACAGTTCCGGACTGGTTCGTACCGAGATACGAGGTTCGTTGCTGCTTACACACGTAGTTGGTAGTTG
CCGTCAGTTTTGGATATGAGGTGGCATCACATGGCCACCTCTCCACCACATCCCTCGGCTTATCTTAAGTTGGGTGGACGCTGGCCTCTTTCCTTCAGCC
ATTGCCCTTATTGACATTTATCCAATCAAATAGACTATTTGATTGCCTTTTAACCTATCATATTGCACAAACCGAGTATACAAACTCAAAAGTATTGCGT
CGCAACACTCCCACTAAAGAAGCCAGCGTTGCCATAAACTTTCTTCTTATTGTCCGTCAACTTTCTTCATATTGTCACCAAAGATCCTTCTCGAAGTCGA
CTTCAACCTTTCTCAGATTTAGCATGCCCAAAATAGCAAAATCAAACTACCGAACTGGGATTTAGTATAACTTTGAATGCTGGGCACATACCCAAGCTTA
AATTCGCAACCCAAAATCAGAAGCAATACTTTATTTCATATTAAAAGTAACTTAGCTTATGTATTTGAAGTTTCCGACTTTTGCGAGAGCTGCTCACTCT
CTATTTTGCTGCTGTCAAGCGCAGGTCCCGACGTTACCCTTCGATGGGGGTTCACAAGCGTCTCCGTATCCCATCAGGCGACAGTGATCCGGCATAGGCC
ACAGCGGCCCTCGTGTCCTGGCTTTTTTGCACCTAAACGGATCGCCAATGGCTCATTGGAGGCACTGCGGAGCGAAAGTCCGGTTATCCGGTACCCGTGA
ATTTCCAGTCTTTGACCATTCGTGCTTTACTTGGTGGTACTAGCCGAGCGCCGCCGCTACGCGGCGGTAATTTAGGTTTTACTCTAGATTTTTGCCTTCC
CGCCTTCGCTTCGCTTTGGCGGGATAATAAGTCCAAATCCTCTG