Description :
From Genome Similarity Track
Location :
Scaffold_233:18916- 20122
Transcript NameFunction/comments
Phyag_g3765hypothetical protein PHYSODRAFT_305491

Sequence
1206 bases(100 bases per row)
cgagtgcagcagcaggaggacgatgTTTACGAGTATGAAGACGtagaggaggtggaggagatggaggaaatggcggacgacgagccCATGCGCATCACTG
GCCGCCTCTTCCTCGGGTCCATCGACGCGGCGAGAAACGTTGGCGCCTTGAAGCGACTGCGAATTGGTGGCGTCCTTGCGTTGCTGGGGGAAGGggagga
agacgccgcagTGTTGAGCCACTCGAGTGCAGTGGATGAACAGTacgcagagctgcagatCAGCAGAGTGAGCATTGAGATGGAGGACTCGGAGGACGGA
GACTTGCTGTGTAAGCTGCCGGGGGTACTGGCAACACTGCGAACATTGGTGTAAGAGTCTTTTCAAGTCGTGGGTGTTGCATTCGAAGTACCGGGGTGTT
AATTTTGTGGCTGTGTTTGGGTGTCACTAGAGAGACGGCGGAGAGGGAGGACACGAACGTGCTGGTGCATTGGTGAGTACAAGGCTATGATACAGAAAAA
ATTGCTGAGTTCTTAGTTTGCCTGGTTACTGGCGTTTTGACTTGCTTTTTTtgctctgcagcatcgcTGGTAGATCACGCTCCGCCTCCATCGTAGCAGC
GTGGATGCTCGTCACTGAGCCAAAGCGGCAGAGTGTGCAAGATGTCGTCGATCGGATCAGGTTAGAGCAACTCATCACTACATGTATACCAGAAACGGGT
TGTCACGTAGCTGACAGCTCTTGGTTGTGATGCAGAATCGTCCGTCCGTGGATTGAAATCAACCCCCACTTCATGCAAGACCTACACTTGTTCAACGCCG
TGCTAGCTTCAACAGATAAAACGCCGCTGAGTGCAAATGACGCTGCGGTGCTGAGAGACCGCACATTTCCGCGGCTAGACTTTGGTGCGAACCTCGTCGA
TGGTATCTTCCGAAACTCCAAGACGATCACGATGCGGCTCTTATCTGACGTCGAAAGTGACCAGAATTCGGGTTTGGGGGACATCTTCCCGTTGTCTATT
GTTGTGGCAACGACCGCCAGCGCTGATGACTCGCTTACACGACCGCGATTCGCCTATCTGCGGATTGATCAGATTAAAACGCAGAAGCTCGACTCCATTG
ACCAAGCCACGCTCCGAAAATCAGGGTTCAACTCGACtgacgaggtgctggaagTGTTGAAGGAGTTCTACCCGAATgtgacggcagcgacgccgctgct
gatgct