Description :
From Genome Similarity Track
Location :
Scaffold_10:1891553- 1892783
Transcript NameFunction/comments
Physo_566561Equilibrative Nucleoside Transporter (ENT) Family

Sequence
1230 bases(100 bases per row)
TCGCTCATGTTCCTCAACGGCTCGGTGCTCTGGGCCTACTACTCGTGCCTGAGCGCGCAGGACTTCTACACGGTCGAGTTCGCCGACTCGGGTCTCGACT
TCTCTTTCCTGACCACGCTCTGCACGTCGTGGCCCATGGTCATCGGCCAGGCTGTCCAGATGATCTGGGGCCTCGACAAGAAGCTCTCGCAGGAGTTCCG
CGTGCGCGTGGGCTACGGCATCTTCATCCTCATGGCCATCCTCATCATGGTCTTCAGCGCCATCAACTTCTCCAACCAGAAGACGGGCGGCATCCTCGTG
CTCATCTGCTTCGGCTGCGTCGGCTTCGGCAACACGCTCTCCGAGGCCACGTACTACACGATTGCCGCGCTCTTCCCCGTGCCCAAGTTCTCGCAGGCCG
TGCAGATCGGCAACGGCACGGCCGGCATCCTCAACATCTCGCTGGCCACGATCCTGCGTCTGGCCGTGGGCGGCGTCCACCAGACGAGCAGCTCCACCAA
GCTGGCCTTCTACCTCTTCTTCGGCCTCCTCATTGTCGTGCTCATCGTCGCGCTCTTCGTGTACCGCCGCCTAACCAGCCTGCCTTCCGTCAAGTACCTG
CTCGAGCGCAACGCCGCGTCGGCCAAGGAGGAGAACCTCACGGAGCAGCCCGTGGGCAAGACGCTCAGCAACCTGTGGCGCATCTTCCTCATCATCTGGA
TGCCGGCCGTGACCCAGTTCCTCGTCTTCTTTGTGTCGCTCTCGGTCTTCCCGGGCTTCGGCTGCGCGGCCACGCGTAACCTCATGCCGCCGTACTCGGA
CGTGACGCACACGGTGACGGCCAACTGGTACTGCGCGCCGGGCATCGTGGGCTCGTACAACTACGGCGACTTCTTCGGCCGTATCCTCACCGGCGCTGCC
GTGTACAAGTTGCTCAACAGCGAGTGGTGCTTCGGCCTGTCCATCGTGCGTCTGGCCTTCATCCCGCTGCTGCTCATGGGCGTGGCCGGCACGTCGCTCT
ACGCCTTTGGCCACGACGACATGGGCGCCATCGCCTACAACATCGTGCTCAACCTGACCATCGGTCTCTCGAACGGCTTCCTGTCCACGGTGACCATGGG
CGTGGGCCCGCGTCTCCTCAACCCGGAGGACCGCGAGTCGGGCGGTGCCGTCATGGTGCTCTGCCTCTTCCTGGGACTTGCCGGCGGCTCCACGCTCGGC
TTCTTCTTCAGCGACCAGGGCTGGCTCGGC