Description :
From Genome Similarity Track
Location :
scaffold_360:18915- 21256
Transcript NameFunction/comments
g7644.t1hypothetical protein

Sequence
2341 bases(100 bases per row)
ACTTGACCCGTAGCTTGCTCTGCGTGGAGCTGCCTGTAGCACTCCAGCGGTGAAACACTTGACGTCACAGATAGGCTAACCAATGTAGCGCCTTCGCTCA
ATTGCTCTTGTCCTTCGTCGGTGTTGTTCTCCGTTTGTGGTGGAGATAGAGTGCAAGAAGCATTCTCAGCAGCTTGTTGGCGGGGGCCCCAGGGGCCTTG
CGCGGTGTTTTCACGCTCAGGGGCTGCGCCAGTGCCAGTTTCAGCAGCACTTGATTGTAAAACAGTAGCGACCGTGGCGGTGTTGTCGCGTCCGTTGCTC
CGAGTCTTTTTAGTGTTAGAAGGAGGTGCGTCGACTTTGCCGGAGGCGCGGCGCTTTTGAGCTGCACCAGGAGACATATTTGCTTCCAGGCTTGGGTTTG
GGGGTTGTAGGTGTTCAGGGGAAATTGGGAAGTGACTAAACTATCTAAGTCTGGTGAGACTTCAAGACTTTACGTTGTCTGTCGGGTCGGGTTCCGTACA
TCAGTAAGTTAGACATCTATCTACAGGTTGTTCTTCGATTGATGGTTCGTGGCTCAGAACGTGCGGTGCTTCTTTGGAGTAGCTGTCGGTTGGCTGAATG
TGAACCTTCTTCAGTACAGGTTCGAGAAGTTTCGCGGCTACAACCGTGATTTCCCCCGGTGAGTGTGGTGCCTAGTACTTCGGCATTTCTAAGAAAGGGG
AAGCTACAATTCCGGCCAAACATTCATCCACTGTCAGTCCTTATCTATTCTTTGCGCAGTCCATTCTCACATCTTCTGCTGCGCGTACGAACCCCGCGGA
AGTCACCAACGCATCACTAGGCCGCGATTCTTTCCAGGTGAGGTGAAGCTTTTATGACTTAAGCTGCGAATTATCTCCACTGACATCGTCGTAATATTTT
GAGATTCTCTCCTGACTCAAGCTGACGGACTGCTAACGAGAAGCTGATCTACGCGTCTACTTTTCAGTATCGACTTTGGCTACCCAGGCGAGGGTTGACT
TGGCGTCTTCGTGTGGTTTTTGGTGTGAAGTGTGGTGGCAACGCTGCTGTCGTTCTGCGCTTCGTTTGCTTGCTCTTGTCGCCTTCTGGTAGACGCCGAC
CAGCTTCTCCGAACTCCTCGCGCAAGTCCGATAGGCTCACTTGTGAGATAGATACAATCGGCGGCTGAGTGATCGGGGTGCCTCAGCATCTATCTCAAGC
GCGACGCGTAATTCCTGCGCTTTGTGCGCCGGTTGTATGGGGTCGAAGAAACGAGGCGCTAGTGGAGCTACGTGTGCACGTTGCGAAAAAGAGTGTTCGT
TTGGAGATCTTTGCTGTGAGCGCTGTAATCGTGACAAAGATGATTTTTCGAGCGTTTTGTTATTCGACCCGGAAAAGTGAGTCAAGGCAAGACTGGACCT
AGAGAATACAATTGCTAAAGCGCTACGTGTCTCGGCAGTGGTGCAGAAGGAGGCCAACCGGTCTGTTATCGAAGACGCGACATTGGTCAGTGACATCCTC
GTAAAAGTGGACGCGAAATTGAAAGAAGCTACGGCACTGCTGAAACTGGACTTAGTTCGCGCGTTGAAGCGTAGTGTTCCAAAGAAACGACGCAGACTTA
TATGAAATAGTTTTTCGCGTATCGGTACAATGTCATCGCCAGCTCAAAATCAACAACACAACGAGGCTGTTAAGCGTTCTCGGCAACGGGAATCTGAAGA
ACAAAGATTTCAACGACTTCGAGAAGCTCGTGAGTACAAAAAGAGAAGACGGGTGACTTCCCAAGCAGTGCCTGCTGTTTTGCAGCCTGTCTCAGATGGT
GTACAGCATGCTCCGCTAGAGCGTCTTCGAATTTCGCTTGGAGCTGAAACACTTGATTAAAGTGTATGCGCCGTTTGCGACCGGTTTGAACTGACACACA
AAACGGTGATTGTGTGTACCGCTGACAAGTCTACTATGAAACATATGCGGGACCTTTTGAACCCATTCGGCTTGGATTTGCCAGTGAAACGCTTGAAATG
TTATTACTGTGGGGCTGTTGACCCGCCGTTGCGTGGTATGCTGTTATCGACTAAAGGAATAGTACCGCCTCGCGAAGGATGTGCGACAAAAATCCGCGTG
TGTAGCGACTGCTATGATGCTCTTCAGAAACAATCACTTCCTAAATTCTCTATTCAAAATGTTTTTTTTCGTTGGCGATATGGACAGTCATTTACCTCAA
CCTACAATTATCGAGCGTATGATGTCCCAGTTGGTGACCGTTGTTGCATTGACGAGGGTCATGCGAGGTGGTGCTCATCGTTCTATCCGATCCCACTGTA
TGACGTTTGATGCAACACCCGGACCGCCGGCAACATTACTT