Description :
From Genome Similarity Track
Location :
scaffold_17:189149- 196218
Transcript NameFunction/comments
Plaha_PHALS_11099echinoderm microtubule-associated 6

Sequence
7069 bases(100 bases per row)
ATATGGGCAATGCACTGTTGCTCGCTGCATTGAAGGACCCCGAGTCTGTAGATTTGGCCGACGCAATTATTCCTTTTGATAACCTGCGACTTTGTGAAGT
AGAGACATTTTGGCGTGCTTTTTATGATTCAGCGACGAGCTTCGCGGTGTCTAGGAGTCAGTTGCGTTCCATCTGCTGCCGCGCTATCACGTTGGGTGTC
CCTAGCTTAAAAATTCATAATGCGAGCATTACAGAGCATGCAGACTCGATTTTTGACTTGTTTTCTCAATCAACAATACTGAGAAGATTCCAGCAAGTGC
AAGTGGAAGCTCGAGGATCACAAAGTCAACAGTATCAAAGATCAAACGACAATACAATATTTATTGACGCACTTGAATTCCTCTCAGCTATTGTACTTAT
TGCCGCTATTTCGATGGATGAGaaaattgacttgatttTTGACTCGTGGGATATGTCGGAGGACGGAGCGCTGGACTTGGACGAATTTACGATCTCTCTC
AAGTCAACGCTATCTGGTATGGCAAAGATTCTCCAGCCTACATCGGGTTGCAAATCGACAAACGTCGATGTAGAagtggatgaagagaacgtTTTTATGC
TTGCAGAATTAGCATTCCAAGAAATCGCTAATTGTGGGGCTTTAATGTCAGAAGGGGGAGGGTCAAAAGAGGAAATAAATACAATTACCTGTGAGCAGTT
TCGGGAATATTGCTTGAAGAATAAGCAAGCGAAAGATATATTACGGCTATTTGACGTGGCTAATTCGAATCTCAAGAAGTTTGAAAGTGGCtttgaagag
gaagaaataTCTGGAGAGCTCATGGCCAAATTAAAGAAGCAAACCGAGATTCCAATCACACCAGCAGATGCTGGTGTGGGTGATATGTTCTTAGCATTAA
AGCCTTGGGTCGGGGCAATTGTGCCTCCAACTAAACCACCACCACTCTGTAATGCGGCCCCTTTAGATTCTGTTAGATTGGACTGGGTATTTGGGTACAG
CGCCCAAGAGTGCAAGAACAATGTACGCTTTGTCACCACAACTGCTGCGGCGAAATCCGGTCACTTTGAAGAGATAGTATATCCAGCTGCCGCAGCATGC
ATTGTTCTGAATACAAAGTCAATGAAGCAGCGTCATCATCTGTTCCACACAGATGATGTGCTGAGCTTGTGTCTGCACCCATGTCTCCCTCTTGCAGCAA
GTGGTGAGATTGGAAAGCAGCCTAAAATTATTGTGTGGGATCTGGATACGTTGGAAGTCCAATGTATTATAACAGGATATCATAAGCGAGGGGTCTTGCA
ACTAGCATTTTTAAGCGCTGAATTGTTGATATCGGTTGGTGGAGATGATGACCATAGCGTTGCGATATACGCTAGCAGTACCTGGAAATCTGCAACTCTA
AAGGTTGCAGTAAAAGGTAACAAAGCAGCACCGTTTCATGTTACCACAAATCCACGCGTGTGTAGCGAATTTGTCATTTGTGGCCAGAAATTTGTTGACT
TTTGGTCACTAGGAAGCAAGGAGCTCGTATCGAAGAGAGCTTTGCTTGGGAAAAAAGGTTCTCTTCAACCATTTCCTGTTGCTGAATACCTCGGAAAAAT
GGATCAGGCTGTGGTTGTTGGGACAAGTGATGGTTCTTTGTATCTTTTTGTGGAAAGACAACTAACAAAAGTTGTTAAAGCGCAAGATGGCGCAATTACT
GCATTGTTTTACTCATCAGGACATCTGCTTTCGGGTGGCCGAGATGGTCGCATAATTCAATGGGACGATAAGCTGAACCAAATTGGTTCTGTGACAAATA
TTCAGGACTCCCTCGAGGGATTATTTTTGCCCCAGCGTAAGGGAATTCGAAGCTGCTGCTTTTCTCCAGATAAACGGACTATTCTTGTCGGTACATTGGC
ATCCGAGATTTACGAATTGGACGCGAAGACAGGACAAAATTTTCACTCGGAAGCCTTAACTAAAGGACATTTCAGAGGTGAACTCTGGGGGTTAGATACT
CATCCGACATTACATCATTGTTGTACGGTCGGTGATGATCAGACCCTTCGCATTTGGAACTTTATTGAAATGTACGAGATGGGATTCATTATGTTGCCAA
TACCAGGACGTGCTTGCGCCTACTCTGGAGACGGCAAGCTGATTGTCGTCGGACTTGGTACTGAAGATTCTGGTAAAATTGGCAACGAATTGCTAACAAA
TTATTCAGCGAATGCTAAAAAACAACAGCCGAAAGGAGGCTTTGTGGTATACAGTGCTATAGACTTAACTTTTATAAAGGAACCCTGCTTCGATGCAAAA
CGATGGGTAAGCGATGTGAAGTTCTCACCAGACAATCGAACACTGGCAGTAGCAAGCCATGACTCTAATATCTACCTATACAATGCACTAAAGGGATTTT
CTCGCACGCACATATTCAGTAAACACTCGAGTGCTGTCACGCACTTGGACTTTTCACGTAATGGAGATTATTTACAAAGCACTTCAAGTGGATACGAGTT
GCTGTTTACGGAAGTAAAAAGTGGGAAGCACATCACAAATGCCACAAGGTTTCGAGATGAGGCTTGGCATACGATGACCAGCACAATAGGGTGGTCTGTG
CAAGGCATTTGGGAAGCAGACAGCGATGGTACAGATGTAAACGCAGTTGATCGCTCGAACAACGGAAAGCTTTTGGTGACAGGCGACGACTTTGGAAAAG
TGAAAGTGTTTAACTTTCCTTGTGCCTTGGATACAGCTCCGTTTCTGGAGCTGCGTGGTCAATCCTCCCATGTCACAAATGTCAAATGGTCGTTTGATGA
TAACTTCATCGTTTCAGTTGGTGGAAATGATCGGTGTATTTTTGTATGGAAACACGACACGCAGTCTTCCAAAATTCCCAATTTTCTCAACCATCGATCG
AGTACGACTGAGCCGTCCAGCAACGAGATCGAAATTATTGGTGAAAAAGAAACTAGTCCTTTTGAGGAAGTGGTGATGAAGGACGATTTTGGTGATGAGT
TCATGGCAGTGAGGCCATGGCTAGGGGCAGTTGTAGCACCTTCGAAGACCGCACAAACGATAATTGACAGCACCTCACCAAATGCGAGGCTAGAGCTGGA
GCGAGTGCATGGATATCAAGCTCAGAACGCGTCTAATAACGCTCGATACGACTCGACAGGAAATGTTGTCTATCACGTTGCTGCCCTTGGCGTCATTTAT
AACAGAACGACCCAGCGTCAAAGGTTTTTTAAGAGTCACGACAATGATATTGTGGCTTTAAGTGCTCATCCGAATGGTACAACATTCGCGACTTCACAAA
TGGGTGGGAAGCCCAAGATCTACGTTTGGGATTCCACTGGCGGAATCGCTGTTGCACCGTGTCTTGAAGGATTCCATCAGCGCTCTATAAACGCAATTTG
TTTCTCAGCTGATGGTAAAAAGCTTGGGAGCGTAGGGGGTGACGATAATCATTCGATTGCGATTTACAATTGGCAAAATGGTATGTTGACGTCGTACTCG
AGAGGTGAACGCAATAATGTACACAGCATGTGTTACCATGCCGCAACCAACGAATGGGTGACATGCGGTGACAAGCATATTCGTTTCTGGGTAGAGCAGG
GTAAGAATCTCACATCAAAACTTGCCACTTTTGGGACGAAGGCACATCAAAGTGGTAATGTTCCGCCAAGATTCGACTGTGTCGTATCCTTTAGCGGTCT
TGTCATCGCTGGTGGCTGTACTGGTCATTTAATTATTTTTCAGAATTCAGTTAGTGTCACGAAAACTGTCCAGGCTCATGGTAGTGCCATACTGGCACTC
TACGCGGCAGAACGCGAGCTGATAAGCGGTGGCAAAGACTCTAAGATTGCAATTTGGGACGCGCAGATCAACAGCATAGCTATTTTCGATCTTACAAAAT
ACACACTTCAAGATAGTAAACTTTTGAATTCTGAAATCAAAAGTATTTGTTCAAGTCCAGGATCTTCTCGACTTTTTCTCGTCGGCCTGGGAGGAAGCGA
CTTGCTCGAACTCGATGCCGGTCGAGCTCAGCCAGCACTCTCAGTAATCACTCAAGGTCACTACAAAATGGAAGTCTGGGGACTCGCATGTCATCCGACG
AGAGCAGAATACTGCACTGTTGGCGATGACCAAACTATCCGAGTGTGGTGTCATGTCACAAAATCGCAGCTGAGAATTCGAAGGCTAGAATGGATAGCTC
GAGTATGTGCATTAACAGGCTCGGCAGACATTGTCGCAATCGGATATGGCGGACGGACGGATATGTCAAAGACAGCTCGATTGAAGACAGGTGGCATGGT
TTTGCTTTCTTATAGCGACTTAACAAGAAAGGTTTTTGAAGATCGACCGTCCAAGCAAGCGATAAGTGAAATGAAGTTCTCACCAAATGGCTTGGTTCTT
GCAGTTGGCTCGCACGACCACAAAATTTATCTTTATCGCCTTAATCACAATGGCTTGAAGGTCGTAAGAACAGCTACTTTCGATAAGCACCACAGTTATA
TCACGCACTTCGATTTCTCGTCAGACAGTCAAATCTTGCAGAGCAATTGTGGAGCTTACGAGCTTTTATTCAGTAATGCTAATACTGGCAAGCACATTAC
ATCCGCAAGCAGTACGAGAGATACACCATGGTATTCCTGGACATGTGTGCTTGGTTGGCCTGTGCAAGGCATTTGGCCACCTTTTTCCGATGGCACTGAT
GTAAATTCTGTCGCGCGCAATTCTAGCGGACATCTTTTGGTCACAGCAGATGACTTTGGACGCGTCAAACTATATCGATATCCCTGTGTTGCGAAAAATG
CGAGCTCAGTCGATTATCGTGGTCATTCGTCGCACGTGACCAACGTCAGGTGGTCTTGTAATGATAGCTACATCATAAGTATTGGCGGTAATGATCGAGC
CATCATGGAATGGCGAATAGTGAGCGAGGATGAACCATTACAAGTAGCAAATGAACCTAATGGACAGACAAGTCAGATGGAGCTCGACAACGAAACTATA
GATTCAAACGAAGAGACGCTGGACGACTCGGTAGGAGATGAATTTATGGCAGTCAAACCATGGATTGGAGCAATTATTGCGCCTACAAATGCTGCCACTC
CCAATTCTCGTCAGCCAGATTTAAATGTGGAGCTAGAATGGGTTTATGGCTATCAATCTGAACATTCTCGACAGAATTTAGTCTACAACGCGCAGGATGA
GATCATTTATCACACAGCAGCCGTAGGCGTCATCTATGACGCCattcatcattttcaaagaCATCATATTGGACACAACGACGACATCATGAGCTTTGCC
ATTTGTAATTTAAGACGAAATTTAGTCGCGACAGGGGAGCGTGGAAGAAAGCCAGCGGTGAGAGTCTGGGACGCTCACACAGGTGAGCTACGCTGTGAGC
TTAAGGGAATTTTGACGCGCGGGATCGCGTCACTTGCCTTCAGTGGTGACTCTACTAAATTAATTTGTGTCGGTAACGACGACGATCATTCATTGGTAGT
CTACAGCGATGCTAGCAGTGGAGCGTGGACGGTAGCCAACGTTTTGGCCGTTGGCAAAGGCGATAAAGCAGTGAATTACTTTGCTTTTTTCGGATCGAAA
GCTGATAGTATCATTACTGGTGGTGTCAAGCATGTTTTGTTTTGGTCCATACAAGGAAAAAGTTTGACCTCCAAGAAAGGCATAATTGGCAAGAAAGGGA
GTTTGCAAACATTCCTGACGGGCTGCACCTTTGCTGAGGACTTTGTAACTGGAACAGTAGGCGGTGACCTTTACGTGTGGAAGGGTAATGATCTCGCAAG
AGTGGTGAAGGCACACGAAGGAGGAGTTCGCGTTGTAGTTAGCAATGTCGTTACCGATCGTCATGATGTAAAAGATTCTGTAGTATTACTATCAGGAGGA
ATTGACGGTCGTGTTGTGATGTGGAATTCTATGTATCAATCACTTAAATGCTTCGACTTGGGTGCAATGCATCTTGTGACTTTCACCAAAGTTATTAACA
GTGTTTGTTTAAATTCATCAGGTCAAAAGATGCTTATTGGGACGTGTTCGAGTGACATTATCGAAATTGAGGTGGCAACCGCGggtgctctgaacaatgg
tCAGCCTCTCTTTTCCGGCCACTTTGCCATGGAGCTGTGGGGCCTAGCTGTACATCCTTCTCAGCGACAATTTGTCACGGTTGGTGATGATCAAACATTG
CGCGTTTGGGATATGGAGACAAAGAGGTTGATTCATAAGCATTCGCTGCCAGCAAAAGCTCGTGCGTGTGCTTATTCTCCTGATGCTGAGCTTTTAGCTG
TCGGCTTTGGAGGTGACAATGGGTTTCGACAGAAAAAAAGGCCCCAGACGCTTTCAAGAGAAGGAGGTTTTGCTGTATATCGAATATCTGATCCAATAAA
TGAGAGGCAAGTGTATGAAGACAAACCTGCAAAGGAGTGGATTAGTGATGTGAAGTTTTCTCCAGATGGAAAGACACTAGCACTAGGATCACATGACAAT
TCTATTTATTTCTACTCGGTAAAAGGAGCATCGGACTTTCAGAAGCGCAAGCCATTCAGCAAGCACAACAGTTATATCACACATTTTGATTTCTCAAATG
ACAGCAAATACATTCAATCAAATTGCGGCGCATATGAATATCTCTTTTGCGAGACAACTTCAAGTACTCAAGTTAGTCGAGCATCATCTGTGCGAGATGT
AAAGTGGTCAACTTGGACGTGCACTTTAGGTTGGCCAGTCCAAGGAATCTGGCCAGATTACGCTGACGGAACTGACATAAATGCTGTATGTGCGTCTTCG
TCCCGTTCAATCCTTGCAATTGGAGACGATTCGGGCAACGTCAAAGTTTATCGCTATCCATGTATTCTCAAAGGGGTACGTGGCACTCATGGTACAAATG
ATTGTCGTTGTAAGCCCATTCAATCATTTTTGTCTATCTGTAGTCAAAATTTATCgcttgtcgaggtcattcTTCCCACGTGATGAATGTGCGCTTCAGC
TTTGACGACAAGTATCTCATTTCTGTTGGAGGAAACGACAGGTCGATATTTCAATGGAAGTTTATGTAG