Description :
From Genome Similarity Track
Location :
Scaffold_1067:1891- 3962
Sequence
2071 bases(100 bases per row)
ACGGCGGAGGCAATATTGCAAACGAAGCCTCGGTAGCACATACACACGAACTACTGAGCCCGGTAAACGTTGTACATACGCCAACGAGTGTTCGTGTCAA
ATCTGGGGTGACCGCCGAAGCGACAAGTAACAGCACTGGATTAAATGGAGTCACCAGTTTTGACAACGTTGTCCCGGCCCTGTGTGCAGCCAAATTCGCG
AACGAGACATCGGCGGTTGATCCAGAGGATGCAGGCATCGCGCTGAAGGTGGTGAATACGGCACCGAGTGTTTATTGCGAGATTGGTGCGAATGCCGAAC
AGTCAAAACAACGGCCGACCGAGGCGCTGAACAAAAGTCAACAGCACAATATGTCGGTTGCCTGCGCATTCAATATTGCGAACAACGACTCGGCAGGTGG
CCCAGAGATGGGAAACCAGGATGGGAAGGAGATGGACCCAGTACCGGCTGTTAAAATCAAAGCGGATGCCGACGTTGGGTCAAGAGAAGAGTCCGTAGCG
ACTTTGGACGGAACGTACATCTCGGTTGCTCGAGTATTAACAACCGAAGGAAATGAAGCAACGGAGGATACGAGAAGTGACTTCTACGAACACCCGGTTA
ACAAGATTGGCTTGGAAGACTACGCGAAGGAGCTGGCATTCCTACCGGACCTGACCGAAGAGATCAACACGACAATAGACTACAATGCGTCCAATGTTGC
TGACCCCCAGCTGTCGCCCGATCGCAGGGAACGTCTGGTCGCGACGCTGAAGAACCACAAGCACATCCTGATTGCTAGTGGTAACGCACTGCCGCCGCCA
GCCTACGGCGCGGTATGCGATATCGACACACAGGGGCACGCTTCAATTAAACAGCGTACCCGTCGCGTGCCGCTACGATTTCTCGCCAAACTGTACGAGC
CGCTGTGCGCTTTGTTGCGAGCAGGACTGATCGTCTTTTCAGACAGTCCATGGGCATCGCCGATCGTGATTGTGATGAAAACAAACGGATGGACATCCGG
CTGTGCATTGATTACAAGATGGTGAATGCTATCACCGCGATAATGGAGTATGCAATGCCGCTAGTCGACGACCTGTTAACAGATCTCGAGCGCTACCTAT
GGTTCTGCTCGTTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATGACCTTGCGAGCGCGTAAAGTGTCGGCGTTTGTCTGCGCACTCGGACATTTCGA
GTGGTTACGCATGCCCTTCGGGTTAAAGAACGCACCGATGATCTACCAGCGTATGATTGACAACGCACTCTGGGGGTTCGTTCAACCTAAAGGAGGTTGG
TTTGAATACTCGGAGAGGATGCGTTTAGCTGAAGAACAGGCCAAGGAACGTCGTGGACCAAGCGCCGAGGATTCGTTTCAAACGAAGTTCGCGGCAGACC
GCGAAGCACCGGTAGAGACCGACCCTGTACTACAACTCGTCAACAGCCCCGTCGCTGACATGTTTACGAACGGGGAATCAGACAAATCATCGCTGGTACC
TGTATTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGACCGAATGCTGGCAAGATTTGCA
CAGTGTCGGATCAGAATTAGCTTCACCAAGAGCATCTTCTGCCAACCCAAGGTGGACTTTCTGTCGCATAAAATTTCGCCAGAAGGCATCAGGGCTGACC
CCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTCCCAACAAGTAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTTCTACGGCCGCTTCATTCA
AGACTTCGCGGTCTACGGTGCGACGCTGTACCAGCTCAAGGATGAAGACTTTGTCGTTGAAGGTGGCCTTTCTGTGGCACGTCGTTCCTTCGAAAGATTG
AAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGAAGTTCACGTCATGCTCTTTGCGAATGAATGGGCGTTGAGCGCTACGC
TAATGCAAGAACATGAAGGCAAGTTACACCCCGTACGGTTCCTCGGTCGGGTGCTTAAGGAAGCCGAGATG