Description :
From Genome Similarity Track
Location :
contig_128:18906- 20109
Sequence
1203 bases(100 bases per row)
AATTACTTCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCC
AACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACG
CATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGT
TGCGAACGCTATCCCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCC
ACACCGCGCGTGGAGTCATTAAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTA
CGGCTCGACGTATCGTCGACCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGAT
CCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAGCTAGCGTTTGAGCCCCCGCAGAACGAGTTCTGATCGAGGGCGGAGTTCCTCGATC
TGCAACAGGGCAAGCATGACATGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAATATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGT
CACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAA
GAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCGCGGCTAATGCCACGACCGCTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCT
CGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGC
ACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACCCAGTATCGCCACGGGCAATTAAAAAACTAAAGGGACTAGCAGGCGCGGGGCGCCCTGCTGGTG
ATG