Description :
From Genome Similarity Track
Location :
Scaffold_86:18900- 21289
Sequence
2389 bases(100 bases per row)
CACAACCTGTCGCAAGACAATGTTGGGAGATTGGAAGGCCCAGATCCATAACGAGTGTACACTTGCAGTGAGGTGGATTAGGGTGGCCTGGATCCGGACA
AGTGTACCCATAATGTGACGACCATAACGATTACGCCATGGATCCGGTGGATCTGATGATAATACAGCTGGGATGATGGGTCAAGGAGAAAAAGGACATG
CAGCCGAACCTGGTAAGGGATTTAGCAGACAAATGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAATTATCAATACAGTCCTCAATTTGTACAG
TATCACGCAAGTGCCTTCCTGCCCTCAAGAATCGGAACTACATTGGCCGTACGAGCTCAGAGAAGGTTGGGAATTGCAAAGATAGTGTTGGACGCGATAA
CTGGATAATACATTGGCCAGATCCTACAATCTAGTGATCTTTCCTTTACACGTGCAGATCCGAAAGGTTAACCGGATTTACTACTTGGCCGGATATACCT
AAGAAGCTCTCAAATCTCAAGATCCCGCTACAGGAGGCGGCAAGTACGACGCAAAGGAAATCAGAGGCAAGGGAACACACCCGCAAGGCAACCCTAAGGC
CAGATCCACGATCTAGGCCCTGGATCCACCAAGCTTGAATATTCGCTAGGGATCCAGAACCAACCACGGACGCAGAGTGAAGATTTTACCACTGCTGCTT
CACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACGCTTCGGAAGTTACCGAGAGAGCAAGATTCCGCCCTACCGACGGGTACACA
AGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGCCCCCTCCGTTAGTCGGTGGCTGGGTGCCGTTAATAAGTTGGATCCAGCAATCTCGCAAATT
GTGCTGATCCCGCTACACCACAGTGGCTTTCTTCGCCACGATGGCTTGTCCGGCTAGAGCTACCGCAGCTCTAGACTGGTTGTTCGCCTCCATCCTGCAG
TTGATGTACATCGACGCCTGGACTATTGAGTCTCTCGTGGCTTCTGATAGCCACTGTCAGGCGCTACAGCTCTCCGCCCCGTGCACTGCGTCGGTATGGG
CGACCGCGTCGGCCGTGCATCCAGCCTTCCCGTGAGCAGTTTGAGTCTGCGCGACTTGACGTCGGGCGAGTTGCTCACGTCTGGTGAGGCCAAGACAACC
TCGCGCCTCGAGCCAATGGCTCTGTGTGCGGAACTATGTTACCCGCCTTGGTTGTGTGGAGCTCTGTTACCCACACCGGAAGCGCATACAGCGACTTCCT
TATCAGTTATAGTCTGAGTGACCTTGCGTGGAGCTCTGTTACCCACGCTCGGAGCACCGAATGTTGGTTTCTTTAAGCAGCTTCGCTGCTTGCGGAACTT
GTTATCCGCAGTGTTCACTTATGTTACCCACCTGGTGAATGCCTTTCGGCACCACCACTGTCGAAGCGCATACGGCGCGACGACCTTCGGTGTTGGGATT
AGCTGGCGTGGTAGACCCGCACACACATCGGACAGAGTTGGTGTCCACCGACCGAGTCAGAGGAATCCGGGCCCTAGCGTCCGGGACCTGTATCGCACGT
CGTAACTGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGTTTTTTTTCTCTTGGTGTTACAT
ACCGGAATGGCTGCTTCGGGGGTGGATTTAGGATCCCATCCATGTACCAAGTAAAATGGAGTATCGCCCCGGATCCTGTCTTGGGCGGTGTTCATTGCGA
AGGTGAGTCGTTCGGCGTACTCATCCCAATCCCGCTGATCCAAATCATGTGCATACATCTTGAGCGCCCTCGTGATCGTCTGTACCATACGCTCGGCCGA
TCCATTGGCTTGGGGCGATATGCCATAGTTGCCCGCTGTCTCTGCCTCAGGATCCGGTTGAAGGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCTGAC
TATGCCGAATCATCTCACTAGCTCCAAATCTCCGAAAAACACACTCCTCGTACGATTCGGCGATGGTTTGTGCAGTTCTGGACGCGCTAGCTTTGGCTAT
CACGTATCCGGTAAACAGATCCACCCAGATCAACAACTCCGTGTTTCTTTGAATGACTTGGATAGTGAGGGGATGTGATCCATGGCTATGATTTGGAACG
GGTAAGTCGCTTGGATATTCCCTGGAGACTCCCCTTCGATTGTGGGCCTGCCCTGGCCCATCTCACAATCCACGCATTCACCGACATATCGCTGCACACT
CTTGAATAGTCCCCTCCAGTGGAAACATTCCCGGATCCACTGGTAGGTCTGACCGATTCCCTGATGTCCACCTTCTAAGCTAGCGTGAT