Description :
From Genome Similarity Track
Location :
Scaffold_1667:1890- 4042
Sequence
2152 bases(100 bases per row)
GGTCGGTTACACTCTAGAAGATCTCAACTCTCAAGATTCCGTCACAGGAGGCGGCAAGTACGACGTAAAGGAAACGCAAATGCAAGGGACACACTCGCAA
GGCAACCCTACGGCCAGATCCACGATCTAGGCCCTGAATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCAACCACGGACGCAGAGTGAAGATTTT
CCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCAGCCCTACC
GACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGAATCATCGGGGGGCCCCCTCCGTTAGTCGGTGTCTGAGCGCAGTTGGTAAGTTGGACTCAGC
AATCTCGCAGATTTTGCTGATCCCGCTACGCCACAATGGTGCGCGTGCCCAGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCA
AGTGAAGATTGAGCCAGCGGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAATAAGATCCGCGGATCGATGGAGTTTTGAGAGG
AACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACG
CAAGTCAAGATCCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCC
GCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCGGGATCCAGGTCA
AGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCGGATCCTGAATCCACGTCAGA
TCGAAGATCCAAGGGAACCGGTAAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGT
AGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTGAAGTCCATCACCGGA
GAAAGGTCGCGCACTATGGATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCATCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGT
CCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCCTGTGAACGTGAAGACTA
GGGATCCAGTACGCCCTACCCGTGATCTGACCCAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGG
TAATCGCTTCACGGATCCGGTCTCGCCAGTGGACCCAGACGGCCACAGGCCCTTCCGACACTTCCTCGGGCACCCTGCAGCGGCACTTTGAAGCTGCGAT
GAATCGCTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGGGACGTGGAGATGGAGTCAGTAGAG
GGGGACAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACGGCCACAGCCGGGGCAGGTGGATCGT
CCATGATCCAGAGGGTACGGATCTCAGCTATATCGGACTTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGT
CAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTTGTATCGGCAGCTG
GGCAGATCAACCAGGAACAAGTGGCCAGATTTTCTGCGCAGTTTCCAGACCCAGTACTGTGGATTAGGAGTGTCGGTGGCACGACAATACTACCATGCTC
GCCGCAGATCGGATGAATCCCCGTTGGAATACCTACATCGACTAAATGTGGC