Description :
From Genome Similarity Track
Location :
Scaffold_955:189- 7142
Sequence
6953 bases(100 bases per row)
ACAGTTTCTTCCGACACTTCCTGGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCAC
AAGCGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGG
CCCATCCCCATCGTCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAG
GAGTTCACGGGCAAGGATCAAGACGAGGATCGAGCGAGAACATGGATCAGCAAGGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCCGAGAAGT
GTCTGACCTTTGCGGATCTGCTAGCGAGGCCAGCCAGGAATTGGTATCGGCAGCTGGGTAGATCCACCAGGAACAAGTGGTCGGATTTGCTGCGCAGTTT
CCAAACACAGTACTGTGGATTGAGGGTGTCGGTGGCACGATAGTACTACCACGCTCGCCGCAGATCGGACGAATCCCCGCTGGAATATCTGCATTGACCA
AATGTGGCCGGGCTACGGGCCAAGTTGAAGGCCAAGGATGGGGGATCTAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGATGTGG
ATCTGGCGGACAGGCTGATCCTGTTACGCCTTCCAGACGCAGATGAGCTTGAAGAAGTACTGCAGGTTGTGGATCGCGCGAAACACCTCCAGAAGAAGGC
GGCAGTCAGAATCGGAAAGTATCGCCAAAAAGCTCCGACACCTACGGCCCCAGTTCGACGCGTCCACCAAGGCGCGGCGCCCGACTCAGGAACTGAATCA
GATTCCGATGGTTTGACTCCGACCCATAGGATTACCGCCGAGTCTGTCTCACTGCGTCCAACGATCGTACGGCGAAGACTGAAGACAACTCTCGCACTGG
GGATGCCGTACCCGGGGACCGTGGGATGTACAGACCCGAGATCTCATGGACGGGACAGGATAAATCAGGTGCTCGCAGTGTGGATCCCGGAAGCACACAA
AAGATGGATGCTGGAAACATCTGGTTTGTGAGAAGTGTGGCAAGAAGGATCATCCCGGAGATCATTGCTTCTACGTGTGCCGCGGTTGTGGCGAGGTTCA
CGACATCGGCAAGTTCCCGATGGAGGAGTTCTACAACAAGATCCGCCAATAGTTTGATCCAGCCAAGCACAGAGGGATGATGCTAGAAGTGGCAGAGAAG
CTGTTAAACTAGGTCGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGATATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATTCAGG
TAGCAGGTCTCTATATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAATTCGCCAGATCC
GAAGTTTCTTCAACCCTGGATCTACAAAGGGGAAAAGCGCGCGGCTACTGGGAGAAACGACAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCA
CTGCAGATCCACCCCCGGTTTGTCCGGTCACTGGACCCGTGGATCTGAAGATGTTGGATCCATGGATCTGCTGACAGGGGAGTCCCGTGGATACTAGAAG
TACCATGTCCCAGGAAAATGGTTCAGACAAGCCAAGGTAGGGGTCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTA
TATTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAGGATTGTGTTGGGATTGGTGAAGGCGTGTACCGACGAATGGG
AGAACGCGGATCCAGATCATGATGGCAGGCGGTTTGGTATACTGGTTCGACATTTGGGTTGGAGATCTCACTGGTCAAGATGCCATCCTCGGGATGTATT
TCATGGTACCAGCCGGCGTAAGGTTGGATCTGGCGGATGGGACACTGTGTTTCCCGGACGAAATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTACGG
GGCGAAGATGAGGATCGTAAGGGCGGATAAGACGACCTGGATCGAGCTCGGAGAAACCTGGGAGCTGCCAGGTCGGTTGAAGTGGGTGGAACATGAGAAA
TGTGGGTCACCCGGGGTGAGAAGTGGGTGCCTACAGTATTCCAAGGACCAGGTCGATCACAATACCTCCAGGTCACAAATGGCAGCGACAAGAGACTATT
ACTGGACCATTATGAGGAGATTGGGCGATGGTTGGCGAAGGATGGTGGGTATCCCTAGGCGACCTGGATATGTGTCAGTTGGATCCCGTCGCTACAGAGA
ATGGCAGAATCTGGCGTATGAGGCGACTACCGAGATCGAATCCTTTGCGGAAGTGGAGCTCCCGGCGGAACCAACTGGCCCCTTGGTGGCCTTCATACCA
AACTTCGCGAAAGTTCCTACAGAGGGATCGTCGGATTGGGATTCAAGTGGTAGAGATTGGACCCAAGCCCGCTGGTGATACCCAGAGCCGGTCCCTCGAT
AGCCCAGGTTCGGTGGATGTGGGATCGCAGATAATTGAAGCCGGCTCGCTGGATCCTGCTGACCCACAGTTGGATTCGAGCTTTTCATAGGACAGCGTGC
CCGGATCCTTGTCGAGAGTGGCAGCACTGGCTAAACAGGAACCGTCGTGTGTAAACTCACCAGAGGATCAAGTCGATTCAAAAGATAGTTTCCCCGGTAC
CAGGATACCCGATCCCATACAGACAGAAGAAATGACGGGAGAAGGGGTGTCGCGGTGCTTGGGTCCAGTGGTGGATCGGACAAAGACTGAAGAAGAACAA
GTCTGCTACCATGAAGGCGGGGATCTACACGCCGAGGGCTTGGAGAAGGTATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGA
TGATATCCAAGTGGATCCGGGGGCGAACGAACCCGCGGAAGTGGATCGACTACGTCAGAAGATTTGGGAAAGCCGAAATCTGTTAATTGGCAAAGCGAAT
GCATTACCACCAGCTGCACGCGGAGTCAAAGGTGATATTGATGTCGGTGACGCGAAGCCGATCGCTCAAAGGGTGCGGAAGGTGGCGCCTCAGTTCCGAG
AAAAGCTATTGAATCTGATTAAGGGTCTGCTACAAGCCAAATTAACAGTTTCTCAACGTCTTCGTGGGCGTCTCCTGTGGTGATCATCGTTAAGAAGAAC
GGAGTGGATAATGCTTGTGTATTGATTCCCGGATGGTTAACAGCCTGACCCGACTGATGGTGTATCCGATGCCTTTAATCAATGAGCTATTGGAAGACTT
GGATAAAGTACTCTGGTACTGTTATCTAGATATGGCAAGTGGTTTTTGGGTGGTGACTATGACCGATCGAGCTCGCGCAATATCCGCATTCATCACACCA
TTTGGACTGTTCGAATGGAGCCGGATACCGTTTGGATTGAAGAATGCACCCCAGATCTATCAACGCCTAATCGATAATGCCCTCTACGGATTTACCCGAA
TACCAGAACCCGTAAGAGGTGAATCCGGGGAAGGTCATACGGAAGTGGATCCATTCGAAGCAGGAGAGCCAGGTGGATTGGGAACTCCATCCGTGTTAGG
ACGCAGATCCTATATCGACGACATTATAATCCCGGCGGAATCTTGGAATCAGTTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAAT
CTCTCTATCAGCGTGGTGAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGTCATCGAGTCTCCAAGGAGGGATTGGAGGCGAATCCTAAAGACC
TGTCTTCGTTGGAAGACTTGTCCTCCCACAGTCGCTACGGGCGATGGAATCCTTCTTGGGTAGTTTGAACGACTACAGTCGGTTCATCGAGGATTACGCA
CTTTTTTGCTGCAGTACTCTATGAATTGAGGTACGTGCTTTTTTTGCTGCGATGGCCACTTCGGCTGTCCGGATCAAGATCCAACAAGCTCTGGCCCTAG
AGATCCCAGATCCACGAGGGGATCCACGTAGTACGACGCCGGAAGACGCCTAAAACAGGAGCTGGATCCATCCCGGGACCAGCGGGGAGAGGATCCAATC
TGGACAGAGCTGACGGAGGAAAGATCGGAAAAGGTGGAGCCTCGGTGGATCCGAGTTCAGCACGCGTTTGTGGAGCTAAGGATAGGATCGCGACGACGCC
CATCCTCCGCCATTTCGATCCGGAACGTCAGCCTACGGTGATAGTCTATGCTAGTGATTGGACGGTCTCAGCAGCTTTGGTACAAGAACATGAGGGGATC
TGCCATCCGATCACCTTCGTCAGCCGAGCGATAAAGCCGAATGAGTTGAATTATGGAGCGGTGGAGAAGGAGATATTTGCACTCCTGCGGGTGTTGGATC
TCAATTATATCCTGCTGGTGGGAAGATGTATCCGGATCTTGACTCGCCACTCCACGCCCGCCTGGTTGTTCAAGTCCGCCGGTCTACAAGGACGGTTGGG
ACAATGGGTAGCTTTACTTTCACCATGTACACTGGAGATCGTAAAATGTTCCAAAGGCGAAAACGAGATCCTGGGAGTTTTGGCCGCGAGCATAACCCCC
AGAGCCAAGATGGACGAAGCACTGACTAGGATCGCTCCTAAGAAAGAACTCAAACGCCGGATCCAGATCCCTATCCCGACGGTACAAGCGGATGAAGATC
TGTACATCCTGAATTTTGATGGATCTGCTCGCGTGCGGCGCGGAGGAGGAGCATACAGCGCAATTATGTGGAAATTGCCCGGATGGGAAGTGGTAAGGGC
CAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAAAGGACTCCTGCTAGGGTTGGATCTACTAAAGGAAGAGGATCCAGAAAGGCTG
GTGATGTGTGGAGATTCGAATTTGGTGATCAGACAAGTGCGAGGTCAAATTGATTGCGAGGCCCCGGCCCTGACGCGGTTAGGGCAGAAGGTAATGGTTC
ACTTACGTGGTTGGATGAATCACGAGCTGGTACATGTCAAGCCAGATTGGAATGCCAGTCCAGACAGCTTAGCAAGTGCCGCTTTACGAAATCAATGTGG
TGTTGAGGTGGAGAGAGGGGCCGAGCGTCAGGATCTCATCAGACTAAACCGACTAGACAAAGTGGTGGTGGTTGGATCCGTGAAGAGAACGGTCCAGGTA
ACGGCTGTCACTAGATCCATAGGAAGGATTGGATCCAGTCCCCAGATTCTAGATGAAGCATTTGTGAAGGGAGTCCGTATTGAGCGGATTCTCAAAGCAC
AGAACGAAGAAGTGTGAATTCTGGGGCTAAAGAAGTATCTGATGGGGGATGTGCGAGACCTGAGTCGGGAGGACGCCAAATCCTACAGTATTATCACTAT
GGATTATGCAGTGGATCTGAATGATTTGCTCTTCTATTGTCCCCCTACGAAACGAGTCAGCGGGGACCGAGACGGACTGATGAGATTAGTGATGCCGGAA
ACTTGCAACAGGATGTCTTACATCACTATCACGCTAGCTTTGAAGGTAGCCATCAGGGAATCGGTCGGACCTACCAACGGATCCGAGAATGTTTCCACTG
GAGGGGGCTATTCAAACGTGTACAATGATACGTCGGTGAATGCGTGGATTGCAAGACAGACGAGGGCAGACCCACAATCGAAGGGGAATTTCCACGGAAC
GTCCAGGCAACTTATCCGCTCCAAATCATAGCCATGGATCACATCCCCTCGCTACTGAAGCCATTCAAAGGAAACACAGAATTGTTGATCTGGGTGGATC
TATTTACCGGATACGTGATAGCCAAAGCCAGCGCGTCCAGAACTGCACAGACCATCGCCGAATTGTACGAGGAGTGTGTGTTTTCGGAGATTTGGGGCTA
GTGAGATGATTCGTCATGATCGGGGGAGCCAGGCTTTATGTCTGATTTTTTTCGAGCCTTTAACCGGATCCTGGGCCAGAGACAGCGGGCAACTATGGCA
TATCGTCCCCAAGCTAATGGATCGGCCAAACGCATGGTACAGACGATCCCGAGGGCTTGTATGTTCAGGATTGGAATCCGAGGGATTGGGATGAGTACGC
AGAACGACTCACCTTTGCGATGAACACTGGTCAAGACAGGATCCGGGGTGACACACTATTTTACTTGGTACGTGGGTGGGATCCTAAATCCACCCTAGAA
ACGGCTACTCAGGTATGGAGCACCATGAAGAGAAACCGAGATCCAAGACGATGGCGATACCTAGTCCAGCAATACTACCGGCAAACAGATCCCAAGTGAA
CAAACGGTTACGAAGTGCGATTCAGGATCGAGCGGATCGACACAGCGAAGACGCCCGTCCACATCAAATTCAAGTTGGAGCGCAGGTGTGTTTGGATCGA
GTGAAGGAAGGATACGCCCGTAAACTGGCCCATCTCTGCCATGGACCGTTCCGAGTAAGGGAGAAGATAGGGTAACACGCTGTGAAGCTGAAAACGGCAG
GTGCCGAATATCGCCTGTTCCCCGTGGTACACGTATCCAAGCTGTAGCTGGTCAAGGAATATCCGGACCGGCCGCAAATCCGTCTCTCGGTGGATGAGTC
CAACCAGGTGAATTTCGACGTAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCTCCGACATGAGG
TCAGGGAAGCGAACCAGATATGGGCGAATTTACCGCAAATTTCAGGTGTATTGACGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACT
GTGGAGCATTACTCTATGATTTCTTGCGAGATCGTACGAATCGGAACCGATTC