Description :
From Genome Similarity Track
Location :
Scaffold_1444:189- 4577
Sequence
4388 bases(100 bases per row)
GTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGA
TTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACGTATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACAATCCCGGATCCG
TTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCTGGCATCACCAGTCTCATC
AATCCATCCCGGTCCTCGTTGACTCTCTTTGTAGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGAT
TTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTTGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTTAA
TGCGGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGATGCTGGATCCAGCCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCC
CGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGATCCTGACGCTCTGCCTCTCTCTCCACTTCGACACCACATCGATTCCGTAAAGC
GGCACTGACCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAAATCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGT
AACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCTCCACAAATCACCAACCTTTTCGGATCTTGTC
CCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCC
GGGCAGTCTCCACAGTATTGCACTGTATGCTCCCCCTCCGCGTCGTACACGAGCGGATCCATCGAGACTCAGGACGTATAGATCCTCATCCACCTGTACC
GTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGGGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCA
AGACTCCCAGGATCTCGTCTTCCCCTTTCGAGCACTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCC
GGCTGACTTGAACAGCCAGGCTAACGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGC
GCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAATTCATTCGGCTTCAGTGTACGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGAA
CTAGAGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATTCTGTT
CCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATCCTCTCTCTGT
TGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATCCCTTCGTGGATCCGGCATCTAACTGGGCCAGAGCTTGT
TGGAATCTTCATCCGGACAGCCTGGAGTGGTCATCGCGGCAAACTCTACCTTCTCTCCAAATCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATG
AACCCGACTGTAGTAGTTCAACCTGCCCAAGAAAGATTTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATT
CGCCTCCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTACTCCACCTTGCGCATCCCCCCAATAGCTCTTTACCACACTAATAGAGAGATTTCACTTAG
TACACGCCTCCAGTAAGCACGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGA
TGGGGTCCCAGGATCCCCTGGCTCCCCCACTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAAT
CCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGCCAAACGGTGTGATGAA
TGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAAC
AGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGA
TGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACT
GAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTT
ACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCTCTGGATCCACTTGGATATCATCAATCGTG
ACTTCTTCTGTGGTCAGTGGTAACTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGACTTGCTCAT
CTTCCGTCTTCGTAGGATCCACTATTGGATCCAAACACCGCGGCCCTCTCTCGCCTGGCAGTCCTTCTATCTTCGGCCCTGGTATCAGGGAAACCACCGG
TTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTAATCCAATGGAGA
GCTTGGATCCACTTGTGGATCAGCGGGATCCGGCGGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGAGCCGACTCTGG
GGATCGTCCCCCGTCCTGGATCCAACTTCCGTTGCTTGGATCTCAACTCGTCGATCCCTCTGCAGGATCGTTCGCGGAGTTGGATATGAAGGCCGATCCA
CCAAGGGCCAGTTAACTCCGCCGGGGGCTCTACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACGACGG
GATCCCACTGACACATATCCAGGTCTCCTACGGATACCGTCCTTCGCTAGCCATCGCCCGATCTCCTCATAATGGTCCAGTAACAATCTCTTGTCGCTGA
CGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCTTGGATTACGGTAGGCACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCA
CCTTAACCGATCTGGCAGTTCCCATGTCTCTCCGGGCTCGATCCAGGTCGACTTATCCGCCCTTATGATCCTCATCCTCGCCCCGTACAACGGTCGCCGT
CCGTTGATTTGGATCCGCATCTCGTCAGGGAAACAAAATGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGTACCATGAAACCCATCCCGAGGATGG
CGTCTTGACCCGCGAGATCTCCAACCCAGATGTCAAACCAGTACACCAAACAACCTGCCAACGTGACCTTGACCCGCGTTCTCCCATTCGTACGGTACAC
GCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCA
CTATCTAGGAGTAGGATTGCTTTTTCATTGTTCTTGCCCCCTACCTTGGCTTGCCTGAACCACTTTCCTGGGGCATGGTACTTCTAGTATCCACGGGACT
CCCGGGTTAGCAGATCCATGGATCCCACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTAGGTAGG
CTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTG