Description :
From Genome Similarity Track
Location :
Scaffold_2478:189- 2741
Transcript NameFunction/comments
Phyag_g12514hypothetical protein PHYSODRAFT_552348

Sequence
2552 bases(100 bases per row)
ttcttagtgaatataccatagaTGGGAACAAAACAAAATGGAAGACAGCGAAGTTTTGATGATATAGAGGTGTTCAACATGGGAACAAAACTGAGACCTG
TCCAATGGGGCTACATGTGTCGAAATTCGCGCTTAGCACGACGGTGGTGGGCGAGTGGCAGCGTAGTACAGCGCCCAAGCGCGACTGAGTCCGTCGTCCA
TGGGGCAAGTGGATAGTACTTCGTATGCCTTCTCGCGATCAAGGACACTGTAGTttgcgaacagcagcgatgtcCACCCAGACTGATTCGCGCTCCAGTC
GTGTACAAAGGGCAGTTTGCTCAGCACTTCATCCCATTCCTCGCGCACAAACCGTGGCGGTCGGGAGATTTCGAGGATCGGAGACACAGGAATCATTTGG
ATACCATGAATGCACTCCTTGTTGGGGCTAAACCACGTTGTGTAGTCGcacttgttgtcgaagaatACGCCCGTGACCTTGTTTCTCGCGAAATTTGCGG
GGTGGACAGGAGGACCGTCATTccgcagcaagaagtacgtGTTCACTGCTCGCACGTAAACCTTGAGGATCAACTTtgccagcgtctgctgctctgcatT
CTCTGTCACTTGGCCGTACAGAGCAATACCATAGAGGAAGTTGACCTCTTCCGATGTGGACTCCTCATCCTTGCCATCGGCCATCGGTGTCACGCCGTGC
GAGTACGAGTGGCCCAGCCACCAGTTAAAGTATCGGTAGCGCGGGAAGTAGGGGTCGGTGCCTACAGGCGAGGAATTGGCCACGTCTCGAATCAAAGTGT
CAACAAGGGTCCGCAACTTGACAGCATCATGCGAGTGGCGCCAATTCGGATCCAGGTAGAGCGccatagcagcagcggtcACAATGTAGCCGTAGTGGTA
GTGGTGGTCATTGTACACGCCATTGCCGAAGTCGACATTCATATCGTTTTTGGTCAATGCCTCGCTTGTAATGATCCCCTTGTATACCGTGTCGTAGACC
AGCGGGAACGCCGATTGATTATTCGCAAACTCTGACAACAAGTGCAGGAATTTGGAGGTGCCGTGCTGCGCCACATCCCTCATTTCTGGGTTGGTCGTAT
CGGCAAGCTGTCTCGCCACAAGACACATCGTACCAAActtttgcagcaactttCCCTTGAAGTAATAACTCCCTTCATGCGGTAGTGACCACTCTCCGTG
GATTTCATCAGCAACTACGCGACACAAGTTGAGCCTCTCGATTTCCTCCCGCGTTAGCGAACCCGCTCGCGGTGGGTAAAACGACGTACACGCCTCTACA
CCTTGGCTATCAGCTTGAGGCACGTGGCAAAGCCACGTCGGGTTGGAATTCGGCGGAGCGACCAACATGTATGCAAACAATGGTCCGTGTGTGTGCGAAT
GCAGCACGAGTTCCTGTTTGGCTTCAGCAGTAGACGGATCCAGCATAGCTTGGAGATGCGTCAGCGCAAAGTGCAAGAAGCGAGCTCCCGGGTTACTACC
TGCAGCACTTGTAAGCTGCCAGTGGAACGCAAATGACTCCGAATTCAGCGTCTGAATAGTGGCTCCTCTCGGATAAACACCCGCACTTGCATGATAAAGC
TGCAGGATCTTGTGATCATCCTGAGGCACCTCCGGTTGCACCGCACTCGTCGAAACAAAAGCTGCCTGGACGACACCCGTGAACTTCGAAGTTGTTGTAA
GCTTGTTGCCCTGGAACACCAACGAGGTGTTTCCACCAGCATTGGAGAAAAAGTAGAGCACCCACTGCTGTCCGTTGTTCAGTGAGATCACGAAGCTGAT
CCCATTCACCTGATGGCCCTCTCTCGCAGGAGCTCCATTGATAGCTGTAATGGCATTTTCCGTGCCGAGTTGCACCTGCAAATCCTGATACTCCACAGTT
GTGAAGGCAGATCCTAACGTCAAGTACGTCCTCATCCCTGCCAAGGAAACGTGCACCCCCATATCGTCCCAATTTTCAATAGTAAGAGGTGGTGTACCCG
ATTGTTCTGCCAACTCCACAGCTGAAAAGGTCCAGTTCTTGATGGTCGGTGGGTAAAAGTAGAAACGAGGAGCTCCGTTGTCGTTGATGGGGCCGTCCGT
CCGGTACTGTTGCAAGTAGCTGACGGAGAGACCGCAGCCAATGACACCGGGTTGGGTCGGCACCACCTTGTACGTATAAGGCCCCGCGAATACAGCGTCA
CTGTCACGTTGCCCGTCCCATGCCAGCAAATTGCCCCACCATTCGTTGGTAGGAATCGGTCGCAGCCGAGCTTCTGGGGACACGAAATGGGGCGAAATGA
GCCTCTCGAGGTCCCCCGTGGAGCGGAAAAccggcggtggcggcggagctgATGGAGATCCAGTGTTGGGTGGTGCGGGAGGAAACAATGAGTACGACAT
GGCGATGATAGAACAAGTCAAAAGGCTGGAGGGAAGATATCTTGGTTTTAGCTGAGACTTGAGGGGTACGTGGCTGCTTCAAAACTGAACAAGATCTGAT
ATTGATGCTGATGGGATGCTTGTCCGGATAATGGGAATACTTGAGTTGAGTA