Description :
From Genome Similarity Track
Location :
Scaffold_2140:189- 2716
Sequence
2527 bases(100 bases per row)
ACGATATTTGTGTGTTCTACTACACCACATGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCCGTCTCACAATCCACACATTCCCCGACATACCGTTGTA
CGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTG
TAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGCGCAAGTCA
TTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGGTTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTA
GGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCC
TCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCG
GCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAATCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGT
GATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAA
ATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGG
CCTTCCACATAAGTGGATCTGGCCCGTACAACTTCTCATCCAGGTAGTCTCCACAGTATCGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATC
CATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAG
CGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGC
GAGAGTAAAGCTGCCCACTGCCCCAAACGTCCTTGTAACCCGGCCAACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATATTC
CCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGATTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCT
GACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGTTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCT
GGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACAAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCATTTTCCATGT
TCTGATCCGTCGTCTCTATTTAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGG
ATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCA
TACAATACCGCGGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGG
ACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCGATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCT
CTTCACCACACTGATAGAGAGGTTCCACTTAGTACACGCCTCCAGTAGGGATGTTACTCTTTCGCACAACTGATTCCACGATTCCGCCGAGATTAGAATG
TCGTCGATATAAGATCTGCGTCCTAACACAGACAGAGTCCCAGGATCCCCCGGTTCTCCTGCTTCGAATGGATCTACTTCCGTGTGATCCTCTCCGGATC
CACCCCTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCG
GTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAACCCGCTGGCCATATCAAGAGAG
CAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATGATTAGAGGCATCGGATACACCACCAATCGAGTCAGACTGTTAATCAGCCGGTAATCAAT
GCACAGACGTATATCCACCCGGTTCTT