Description :
From Genome Similarity Track
Location :
Scaffold_2626:189- 2493
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2626-snap-gene-0.2Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_2626-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
2304 bases(100 bases per row)
CCGATCGCGCCGTCATCCTCGACATTCTCCATCGCATTTCACAGCGCGGGCGATCGCACAAAGAAGAGATCAGTCGCCATGGTGGCGAACTCGCGATGAT
CCGAGGCGCACTCGCTGGTTCGCAGGCGTGCAATGACATGGACTCGACGCTGTGGACGCTGTGTCGCGATGCGTTGCTGGAACAACTCGTAGGGAATCCA
AACAGCCTCGACCAAGTGCATGGCGTGATCCTGTTCATGCTGCAGCACCCGGAAGCAAAAGTGCAGATCTTTGGCGCTCAGGTATACGAAAATGAGCATG
GGGAGCTGCTTTTTGAGAGAGATTGACAAGCTGACTTGGTGGCTTCTGACTTATCGTTCTCAGATACTTCGGCATCTTATCACGCCAGACTCGTTCTACG
TGGACCTCAAGTACCGCAACGCGAAAGCTGTCGAGCTGGTCGCATTAGGAATGACGATTCTCCAGTCAAGCGACATCCACTTGCAGCACGAGGGACTTGA
GCTCGTGCACTCGCTCTTGCAGAACGAGCAGTTGCAGGTACAAATGCGAGAGGAATGAAGTAAGTTCTTAGTGCTTCCCGAACTTACAAGCTGTTGGTGC
AACCATATACAGGGCAGGATATGTCAAGCGCTTGTGGAATGGACCAAGCAGACCGTCCTGGTATCTGAACCGTGCGTGGTGGATGAGAATGTCTTGCTTC
GCTGTTACCATCTGAATTATTGACTCTTGATTGCATGTGTGTTTTGTCGGCAACGTTAGCGTGGATGAGCGGTTGGCGCCCATTCAGAGCTCGCGCGAGT
ACGAGACGTTTAGCCACATGCGTTCTCCATTTGTGCATGCCGCCCAGTCCATCAACACGCTCATGCACTCGACACCAGCAATCCTGCCCATCATGGTACT
TGCCTTTGGATGTATATACGCATGTCGAGATTATGGTGTCACCCTTTGAATGCCCGGATTGTCCACATTGGATGTTCTTGATCGCTGTGTTGAGGTCATG
CAATGCGAGGTTCTCATGCCACTGTCGTTTGGGCTGCTGGTCGAACGCCCACAGTCGATGAAGTGGTATGCCGCTGCGATCGCGATCCATTTCGTGTTCA
CAAAGTGTCCGCAGGTGAGACAAGATCGCTATTCTATATTGGTGGCATCTGTGGTTTTGTCGTTGTTCCATGAGGACGTGACGCTGACAGAGCGTATGAC
GCATAGGCTGCAGCAGCGCATCTCGCTCGGATCTTTGCGCTCTCCATGAAAAGGCTGCTTTCCTGGAGAACGTTGCAACCCGAAGACTTGGCCGCAGCCT
TGCTCCAGAGCGAAGACCACCAGCGAATGCTGACGCTCCAGTTTTACGAAAATGGCTGGCGGAAACCCATTCGACCAAAACGTGACGCCAGCAGTGCCTC
AGCGGACCCCATCGATCTGGAACTGAGCGAAATCGAAGCGGACATTAACGCGGCCGTGCGAGATTACGTACCTGAGGTGTGTAGGCATGCATCTTCTGTT
TTTCTATTGATGACCTGCGAATCATTCTTTTTTTATATTTGATGTCGACAATGCCGCCAAATATGGACAGCTCCAATGGCAACCACATCACGACCTAGAG
TACGACGAGCGCGACTTGTACTGCGACGACATGGACGAGCAGTGCGAACAGCAGATGCGCGTGCAACTACAGCGCCACTTTGCGCAATTCCGGATCTCCT
CGTGGGATTCCGCAGGATTGCCATCCCCTGTACGATCACATCAGAATGGATAAATCCAATGCAATTGCATACCGTGAGCACAAAAAAATACCTCATTATC
GATCCGATTGCATCCATTTACTCGTTCGCTCACTGATGATGAGGAAGCGCCATAGGTCAACTTAATTAATTCCTTCTTCCGGCACAAAGTTTTCCTCGAG
ATACCGCGAAAGCTGCTGCAGCTGCTCCGACACGACGGTCACTTTGTCGCGGCTGATGGCAAAGTCCTTCTCGGCGCCGTATGTGCTGCGGCCGTACGTG
CGGTAGTCCGACACGAGGTGGATGTGGCTCGCCAGCTCCGTGTGGATCTCCTTGATGAGCTGCAGGAACTCGGTCGACGACTTGTTGAACGCCGTCGTCG
CGCTCTCGTCCGACGAGATCCGCGGCGCCACGTGGCTCATGGCAGTCGCCGCCGTGCGCAGCGCCGCGACGAGTTTCTATAGCCACGTTAGAGAGAGAGA
GAGCTATGCGTTAAGCGCGAGAAGACGGAGAGATGGCACGGCAGAGATGCTTGTGCAATACGCAGCGGTACCTTCTCGACGGCGTCGAGCGACTGAAGCA
CGGC