Description :
From Genome Similarity Track
Location :
Scaffold_383:189- 2132
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_383-fgenesh-gene-0.6Homology to unknown gene
Pytve_DAOMBR484maker-pve_contig_383-snap-gene-0.22Vertebrate sel-1 suppressor of lin-12-like (C. elegans)

Sequence
1943 bases(100 bases per row)
GCGCAGCCCGAACGGCTTGTTGTAGGCCAGGTACGAGTCCTCGTACCCTGGCTCCGGGTTCACCGCGTACCCCGGCGTGAAGTGCAGGCGGAAGTCGTAG
TAGAATGTCGGCTCTTTCAGCAGTTCCGCCTGGTCCGCCTCGGAACAGCCCGACATGATGGCTGTGATCGGCCCCTTCTGCCCGACCCACGCGGCCGTGA
GCTGCAGCACCGACTGCTGCATCAGCCGGTTGCGCTGACCGCAGCTCATGCTGAACACAATGTGCATCTGGCTGTCGTCGTGGTCGCCCGGGAAGCGCAT
CGCCGCCTCCGGGCTGCTCTTGCTGGCATTGTCGTCCGCCGGTTGCTCCTGCCGCAGTTGCTGCTCCGCCACACTCCACGCGCCGGTCGAACTGGTCGTG
TTGACCACCTGGAGAAGCTCCTGGGACCGCAGCACCTCACGGATCTCCTCGAGTAGCGCCTCGGCGCGCGCCTGGTGCTCCAGCAGCGCCTTGGGGGTCG
CCGCCTGCTCTGTCGCGGCCGTCGATGCCGCGAAGCCGTAGTAGTTGAACACGGTCAGCAGCGCCACGGCGACGACACCGAGCGCCGCCACGAGCTTGAG
CGGCCTGCGGTCCGCGTCCGGCGCGTCGGATGAAGCGGTCAGCGGCTTCATGTGTCCGAGTTGGGTCTTGGTGGACTGACGCGCGAGTGACGTGGAGAAG
GCCACGGCATTGCGGCCGCAACCGTCCACTATACAAACATCAAGAGTGGCACGGTCAGTCACCCGCACCAAATTTCTGCACCGTCCCGGCTCGAGATTGC
GCTAGATTGCGCTAAGTTCGACGGATTTTCCTCGCATCCTCGCGTGCTTCTGGCGGCGCTGAACATCTAGCATTAGCCAAGCGGGTTCAAAGCTGGTGGC
GAGGCGAGCACGCCATCGGCGAAGCTGGGGCCACTCACCTACCTGCGCATCGAACGAATCAAATCACATGTCAGCTGTCGGACCGTGGAAACCCATGGCA
GTTCGTCGTTGAAGCGGGCACAAGACCACACGATCGTCCCACGCTATCGCCAAAGCTGAGGATGTCCTTCATATGCTGCAGTGTTGATTGGTTAAATGTG
GGATGATGATCGTAATGATTGTCCATAAACGGCGTTTTTGCGCACATAGTCAAGGACCCACAACGAAAATAAAGGCAAAAAAGTCGAAGCGAATCCAGAA
GACTTTCCCTGCCTCTTCTTCCAACAGCAAAAACTCAATCCAAAATGCTGCATACAAATTTGTAGGTAAAACTTCCGACATAGATTCATTCATGCTTCAT
TTGGCGGGAACGGTACGAATTTCAGCTCGACCCCTTGAGCCGCTGGTACCACGTGGTTACCGTTAAGGATAACAGGGGCCGAGCGCGTCTGCTCCTTCTC
ATCCCCCGTCGCTCCAACTGCCGCTGACTGCGAACGCAATTGGCACCGCAAGTCGACGACCAGACGCTGCGATCGAGACGAACCCTCTGTCGCCGCATTG
TTCTGCTGCGCGATCATCACGCGAGCAATCTCGTCTGGCTGCATCCGAACACTCCAGATGTGGAACCGAGCGAGCTGGCCCCAGAACCCGTCGCCAGTCG
AGGACGCCCCAACATGCCGAGACAGACCGCTGGCAATCGCAACGAGACGGGTGCCAGCGCGCCGATCGACTTGAACCAGGCTATCGCTGAGATCGCTGAA
CCGCTTTGACTGCAGCACAAAGTGCTGTCGTTGCTGGCCATCGACAAAGAGCGCGACAGATTGAGTACGGGCGTCGAAGATCAAAGCGATGTGGTACCAG
CGAGCGGCAGTGAAGGAAGATCTCGAGAAAGTGACGACCATTTCAGGGTGGTCCGTGTAGACAAGCGAGAACTTGCGGAACTGCAGTCGCCACGTTCGCG
GATCGTCCGACGCTCGCACGAACTCGACCTGGAAGTTGTCGAG