Description :
From Genome Similarity Track
Location :
Scaffold_1:1889888- 1893412
Transcript NameFunction/comments
g585.t1hypothetical protein

Sequence
3524 bases(100 bases per row)
GTTTACCGGCTTGCCACCCGTGCGGCAGAGGTCCAGGAAAAAGTCACAGTCGGGGACGGATAGCAGCGTCGACACCGTCTGAGGGTACTTTGCAATAAAA
GCACTCACCGTACTCCTCGGGTTCGCCTTCAGCTCCGACTGGTCAAACAGATCGCCAGAGCTGTCGCGGCGGAAGCGCTCCTCCGTGCGCGTGAGGAACT
TGCTCACACGCGAGAAGAACGTGTCGTGCACCCAGCGCTGCGGTTTGCCTTCGATCTCCACGTACGTCAAATCGATCATACGCGTCAGCACGTCTCCGTA
CGACATCTCCTCCAAGTCAGCCGAGACGCTCTCGCCCGTCTCGACATTGCGCTTGCAGCCGAAGTACGGCTTCTGGTAGTCCGCGTTCAGACGCGCAATG
ATGTCCTTCTTGTTGAGACGAAGCGCCAGCTCCACCTGTTCGCGCGGGATGGAGAAGTACTTGTCATCAAACTCCTTCCACAGCAGAGCACAGCGGTTGG
CCACAACGTGAATGGGCTCGCCCAGCTCCGACGTCACCGTGATCACGCCGCCCACAGCACCCGTGTAACTCGTTTCCCACTCCAGCTCCGACTCGATACC
GGGGGTGTCCACAAGCAGCTTCTTCACTTCCGGCGCCGTCGCAGCCTCCTTCGCAACCATCACGCGAGAGCCCAGCAGGATACCATCCGCAGGCATCTTG
TGCAGGTGCCCACGGGCCAAGCTCCACTCGCCCGTGATGTACTGCTTCGAGTCTTCCCAGTTGCCGAAACCAGAGCCGACAACCAGCAACACGTTTGGCA
CGCGCCGAATGTCCGCGTACGTATCCTCCATCGGCTGGTGGAAGTCTTCGAAGCTGTGGTGGCCACCGGCGCGACCGCCAGTCCACTGCAGCATCACATC
CATCGTTGGCATCGCCGCTGCAATCTCCAGCACCGCATTGATACCGTCCACCGAACCGGGCTTAAAGCACACCACATTGATGCCCACGGCCTTCAGCTGC
GACATCATTTCAAGCGCACGCTCCTTCGTTGGGATACCGGCACCAATCGTAATGCTCTCGATAGGCACACCGCTACTACGCATGCGGAGCACCATCGGAA
ATTGGAAGCCCCACTGCTTCGCGTTCAGGTACAGCATATTGATCGCAATGCCGAGGCCAGGCTTGATCTTCGACACGAGTTCATTCACCGCATCCTCGAA
GATGTTAGGACGCGACAAGCCACCCGCAGCAAGCTCGCCGTGGAAGCCAGCGTTCTGGATAGCCGCCACGAGGTCGATGCCCTCCAAACTGGTGGTCGGT
GTCATGCCTGCGACCATAACCGGCGGCTTGTTCAGCACGCGCGTGAATCTGTTGCACAGCTTGCCCGACTCCGTCACCTGCGGGCCGAACTTCTTCGCCC
ACGTCGCCTCAGCCGAGGTGAACGTCGAAGCAGCATCAATGAACTGCTGCAGGCCGACCAGAGGAGCGTACCTCGTCGTTGTGTTCATGATCGGGTGCTT
GGCAGTAGCGATCACCACCTTGATGCCCAAGCCTTCGGCGGCCTTGTCGCTCAGCTTCGCCACGCCGAGGTCCGGACCAAACTCAAGGATGTGGGTCGCG
TTCGAGTGGTGCTCTGCGATCTTTGCCCACGTCGCAGTCCAGTCCACGAGCTGCAGCAGCTGCATGTTAATAAGTTCATCGATCACGTCGTCCACCGTCT
GCAGGTTGGTGGCCTCCGCGTTCGTAGCGTACACGGGCACCTGCAGTTGGCTGCCCTTGATTTCGCACTGGACGCGCTGCACGTCCCGCACCAGCTTTGG
CTTGGCCTCACTCAGCAGCGGTGTATGGAAGGGTGCCGAAAGCGGAAGGAACGAGAGCGAACCCGTGGGTTTCCGCTGCGAGTGCGGGATGCGCGTTTGC
GTGGCGTCGGGCTTAGCGAACAGGCCCTCGAGCGCCTGCTTCAGCAGCGTCAGCGTCGCGGGGAAACCCGTCACGTTCATCATGTCTGGCGCATTGATTA
GAGAGAGTTGGAGGTCAGGTGACTTTGTCCGGCGCTTGGCAACTTCGATGGCCTTGACGACGTGCTCCTTCTTGAGCCCCCGCACAGCCAGCATGGGGCC
GGCGTTCCCAATCTTCTTACCATCTTGCTTGTATTGGGTCAGAAGCTCCTGGTACGTCTCCTGCGCACGCAGTCCCTGCCAGAACATGTAGCGCAGCACG
AAGACGCCGACGTCGACGAACTCCTGGGCCGTCTTGGCGACCGAGAAGATGACGGCGCTCACCACGCCCTGGCTGTGGCCAATGGCCGTGGCGGAGCTCT
TGACCACGCTCTCGTGGCTCACGCCCGTGGTCTCGAGGAAGTTGAGGTAGTTGGCACATTGCGTGAGCACCAGCAGCGGCATACTGAAGTAGACGCGGTC
CAGCGCCAGCTTTGCGGGGGCGTCGCCGACCTCGAGGCTCTGCAGCCAACTGTGCACGTCGATGACCGTCTCAAAGGCGACGGAGCACTTGGCCTCATTC
GTGCTGGACTCCTCCAGCAACGCCTGGGCCGCGCTGTCGATGAACGCGCGCGTGGTGCTTGTCTCGGACGCGGCGTAGAGCCGCTGCAACTCGGTCCAGT
AGGAGATACCCTGGCCACCGAACTCGGGGATTAACGTGAACTTGCCAGTGTCCATTGCGCCTGCCAGCGCGGACACCGACGTCGTCGTCTCCTCCGTCGT
GGTGGTCGTGGTTGTGGTCGTGGTCACGACCGTCTCCGTGTTCTCGCCCGCCGTCGTAGTGGTGGTGGTTGTGTGGATTTCCTCGCTCATGATAGTGGTG
GTGATTGGCTTTCGTGTAGTAGTGGAAGCGCAAGCAGGGAGAGAGAGATGGCTGCGTCTGGAGGCCCTTCTTCGCCTTCTTCCTTTGTTGTCGTTTCCTG
CGCGTGCGAGTGCGGACGAGTGAGCTGCGAAAGGGAAATGCTCCAGTGGGGAGGGCTGCAGCGCGAGCCGTCTGGGCCTGTCGATTCCCTCTCGCACCGA
CTATGGATTCCCCGATACGCAGTCACCAGGTAGAGGACCATCACTCTTGCAGACGTTCGCGATCTGCTGACGCGCAACCGAGGTGGCGCATCATTACTGG
TAGGCTTGAGCACTTTCATGATTAAATACCCCGTAGTATGCGAATGTACGGAACTGCCTCATTAGACCGGACTAACCTCCTGTATCCGATTCCCATGCGA
AATCGGATCGCAGCAGATGCACTGATTTGCAAGGGGTAGGGGACGTGACGCACTTTGGCTTTGGCCGCCTCGGCCGTTGACGTCACAACAGCGCTTTATA
TCGGCGCGCTCGGCTCACCAGCCGGAGCTCCGCTGCAGCTTCTTCAACCGAAAGCGCTGCTAACTAGAACGCCCACCGCACTGCCTGCGACCTCTATGCC
GGGGCTGGAGCGATTTAGTATGCGCGCCGCGCCGAGTCCAAGAAGCGGGGCTGAGCAGCAGGATGCCGCCTCGAGTACCGAAGCGCTGACTGCCCGCCGG
TAGCTTCTGAAGTTTTGCGCGGGC