Description :
From Genome Similarity Track
Location :
Scaffold_10:1889758- 1891071
Transcript NameFunction/comments
Physo_526965Equilibrative Nucleoside Transporter (ENT) Family

Sequence
1313 bases(100 bases per row)
AGAAGACCCGCTCGAGATCGGGCGCGACGGCATGCCGCCCGAGATCTGGGACGATATGGTCAAGCACGAGAAGTTCATATACTTCTCGCTCATGTTCCTC
AACGGCTCGGTGCTGTGGGCCTACTACTCGTGTCTGAGCGCCCAAGACTTCTACACGGTCGAGTTCCCGGAGTCCGGCCTCGACTTCTCTTTCCTGACCA
CGCTCTGCACGGCGTGGCCCATGGTCATCGGCCAGGGGCTGCAGATGGTCTTCGGACTGGACAAGAAGTTCGGCCAGCGCACGCGCGTGCACGTGGGCTA
CGGCATCTTCATGCTCATGGCCGTGCTCATCATGGTCTTCAGCGCCATCAACTTCTCGAGCCAAAAGACGGGCGCGATCCTCGTGCTGGTCTGCTTCGGG
TGCATCGGCTTCGGCAATTCGCTGTCCGAGGCCACGTACTACACGTTCGCGGCGCTGTTTCCCATCGAGAAGTTCACCAACGGCGTGCAGATCGGCAACA
CGTGCGCCGGCATCCTCAACATCACGGTGGCCACGGTGCTGCGTCTCGCAGTCGGAGGCGTGAACCAGACCAGCAGCTCCACGAAGCTGAGCTTCTACCT
GTTCTTCAGTCTGTTGGTCATCGTGCTCATTTGTGCCATCTTGCTGTACCGCTACTTGATCAGCCTGCCGTCGGTCAAGTTCCTCATGGACCGCAACGAG
AGCTCGACCAAGGAGGAGCACCTGGCCAGCCAGTCGGTCGGCCGCACACTCAAGAACCTGGGCCGCATCTTCCGCATCATCTGGATGCCGGCGCTGGCTC
AGTTCCTCGTCTTCTTCGTGTCGCTCTCAGTGTTCCCGGGCTTCGGCTGCGCGGCGTCGCGCAATTTGTTCCCGCCGTATAACGACGAGGCCCACACCCT
CACGTCCACTTGGTACTGCTCGCCGGGCATCATCGGCAGCTACAACTACGGCGACTTCATCGGCCGGATCCTGTGCACGGCGGCGGTGTACCGCGTGGTG
ACCATGGGCTGGGCCTTCGGACTCTCGGTGCTGCGGATCGCCTTCATCCCGCTGCTGCTCATGGGCGTGGCCGGCACGTCGCTCTACTCGTTCCCGTTCG
GCAGCATGGGCGCGCTGGCCTTCAACATCGTGTTGAACCTATTGATCGGCATTTCGACGGGCCTGCTCTCGACCGTCACCATGGGCGTGGCCCCGCGGAT
GTTGAAGCCCGAGGACCGCGAGTCGGGCGGCGCCGTTATGGTCTTCTTCCTCTTCCTGGGCATCGCCACGGGCTCCACCTTCGGCTTCCTGGTCAGCGAC
AACGGGTGGCTCG