Description :
From Genome Similarity Track
Location :
contig_28:188973- 191025
Transcript NameFunction/comments
g5613.t1hypothetical protein

Sequence
2052 bases(100 bases per row)
CGGCGTCCCAGCTTTTCAGACGTGATCGAGCGTGGCCTCTCATCGCCAGATGCGGACGACTCTCCGCGTCCAAAGACGTCCTCGTGGTCGTCGCCGACCT
CGACGGCCACGCGTGCCTTCGGAGGACTCTGCTGGGTCAGAGTCTGAGGTCGTAGCTGTCCTGATGAGAGATGGCGATGACCACCTCACGCGCGTTCGTG
ACGTTGAAGTCGCACGCCCTCCGTGCGACGCGGCGAGCATCACACGTCTCTCCAGTGTGTCGTGGAAACGTTTCCTTCACGACCTGAAGAGCTGTGAGAC
CGAGCAAGTTTGCATGCTCGTCGCGGAAGACCCCCCGACTGTCGCAGCCGTCAGTGCTGATTCCTACGACTGCTCGCACGCGAAGCGCGCTGCGCTGCTC
AATCGTTACCGGCGCTTGAGGCGGTCGGCAATCCTGTTACTACGCTCGTCCATGAATTCATTGACATCTTCCCGGATAAAGTCCCCGCTGCTCTTCCCCC
TAACCGTGGAGTTCGGCACGAGATTGACCTCGTGTCTGACGCGAAGTACTGTGTGACGCGACAATGGCCACTTTCCCGAGACCAAGGCGAAGCGATCGAT
GCCTTCTTCGAGGGTCGCCGACTAGCCGGCCACGTTCGTAAAAGTATCTCCCCGCATTCCAGCCCGACGTTCTGTGTGAAGAAGGCTACTGGCGGATCCT
TCACACCTTTAACAAGCTCAACGATGCCACCACCCCGGCGCAGACGCCAATTCCGCGAAAAGACATGGTGCTCGACACCACGTCTGGCAGCACCTCATAC
AGAACTATCGAGTTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGACGACGTGCCGTTGACAGCTGTCATCACGCCTAGTGGAATGCTGCGGGAAT
GGCTTGAAATGCTGCATGGACTCAAGAACGCTCCGGCTACCTTCAACCGGATGGTCTCCAACCTGCTGCGGCCTTTCCGTGACTTTGCGCCTAGCTACTT
CGATGCATCTTTATCCTCAGTCATGCCGCGCGGCATGACTGATGTGCACCTGGATCACCTCCGCCAAGTGTTCGAAGTGATGCGAGACAACAAGCTGTAC
CCCAACCTGAAGAAGTGTATCTTTTGCGCTCCCGAAATCCCGGTGCTCGGGAGCTACGTCAGCAAGGAAGGTGTCCGTGCTGACCTGGAGAAGATCGAGG
TCATTTGTGCATGGCCTCCACCCCAACACCAGAAGCAGTTTCGCCAATGGCTCGATCTCGCGACGTATCTCCATTATTACTCGAAGAACTTCGCACTGAT
TGTTCGTCCACTATCTCAACTGCTCAAGGCAGATGCCACGTGATCATGGCGACTCGAGCACCAGATGGCATTCGACGCGGTCAAGACAAGCCTCTCCACA
TCGCCCTTCCTGATGTGACACGAAGCCTTTCCACGTGGTGTGTGATGCGAGCGACTTCGCCAGCGGCTGCGCCCTGATGCAGTTCAGCGACGAGGGACGC
GAACAAGGGGTGAGTTAGTTACCAGTTGCGTCAGTTGAAGCCAGTGGAGAGAAATTATCCCGTCCACGACAAGGAGCTGCTACTGTAGCAATGCGCTACA
CGCTCATCCAGTTCCGACTATACCTTCTCAGCGAACAGACATTCGCTATTTTCAGTGACCATGCGTTGCTGAGGACAGCGACGAAGAGTCCCCTCTAAGT
CAACGCATAGCACGTTGGTTCTTGCTGTTCTACGAGTACGCTTCGTCGTGCACTACAAGCCGGCAGATGAACATACTCATTGACGCACTCTCGCGTTGAC
CTGATTACGCGCAATCAGGTCGCCACGCGGTTGGCGACGAGGATGACGATGAATGTGCCGTGTGTGTATCTGACGAGTTCGCTGCCGTCGAGGTCGCAGC
GACTAGTCCGCTCCCTGACGTGATTATATCCGCGTACGAGTCGGACGCGACATGCTCCGAGATGATCAAATACCTGTGAGCCCTGTCCGACGCGGCACGA
TGTCTACTGTCTCCGCGTAGCCGCGCACTTATCGATCGATACGCGCCGGATG