Description :
From Genome Similarity Track
Location :
Scaffold_476:18897- 23606
Transcript NameFunction/comments
Phypl_g8709hypothetical protein PHYSODRAFT_297590
Phypl_g8710hypothetical protein PHYSODRAFT_555716

Sequence
4709 bases(100 bases per row)
AAAGACACGAGTACCTCACAggtggctgttgctgcctgGCTGATCACCAACTTGCCTTGGTGAAGAGTTTCCTCTCTGTGTTATTtgtacaagaaggcgg
cAGTGCGCGGCACTGGCTTCAATGACAAAGAAAGAGGCACATGTACTGGTGGAAGCGGCTGACGCGGTAGTGCAGCACCTAAAACAAAGAGCAGTGATAT
GACAGTCGATCGCTCTCCAGGTGGACGTACTCGTGCTCGTCAGCTTAAGGTTGAAATAGCATATTACGTCTGCTGTAAGCTCCGAACGTTCTACATGTAG
CCCCTGGCTCCACGGTCACGGATACCAAGCTATGTTTCCGCACGAGAGAGAATGGGCTACAGCGCATTCTCTGTAGCACCAACCTTCACACTCTTTATTT
TATTTTGGAACCCAATACCGTGTTTTCATATAGTACAGACTATGGAGTGTGGCTGTCAAAGATCGCCTACACTGCACTAGAGAACACGAATACGTTGCAT
TAATGCGCCACATACTGCATGCAACACGGCGCTACTGTAGCGGATGGCACCAAGAACGGAGAGCAAAGCCCCCCGGAAGAAACATCCTAGCTTGAGGGAT
GTTTCtaacagcagcagttgggCTCACCCCGACTTTCTCCTCTAAATTATAATGAATGAGCGTGTTTGCAATTCTGTTGAAGAAGATAAGGCCAGCAAAT
ATTTGATTCATCCACACGCTGCTGATGAGAAAGCTAGAGGAATAAGCTTGCATGGTCTGGGATGATATCTCTGGCACCTCTCATTAGCAACTCGACGTCG
AACCACTCGCCACGAGCACTTATAGCACGTGTAAATCCAGCAGCGAAGCGTTTGAGACCTCTAAACCTCGTTGATAGATTAGCCACCCCTTCGTTCTTGT
CGGCACTACCTTCGGCCTCTTTTTCGGTGGCCAGGGCTGTCGTTTTGCGAAAAATCAGTCATTGATAGTACATCGAGCAGAATGATATTTTTACGGCGGT
GTAAAAGTTCATAGGCCTACAGAATATTTACTTTATTGTTATTTCTTGAGGCATCATTCGTAGCAGCTGCATGTAGTATTCCATCTCCGGAGAAGTCATG
TAGTGAGTGATACACATACGCAAGCGATAAGGAGTAAATCGTATTGAAAATGTGAAAGAAGAGAACCACCACCCAGCCAACTCTGATCATACCTAGCTCA
TGTAAGGGGGTGTTTCTTGGCCGTTCATGCATGAGAACTTCCTTAACGAGAGCATACGCCTGCGCTCGCAGCCGATCTGGCTTGGTCGGCTATTCGGTAT
AATTGCCAGATGTCGGGGCGCGCAGGAATGGCGGTACGTTGGTGATTTTCCTGGTCACGTGCCTTCTCCCCACAAGGTCGTCCGGAATTGGATCACACCT
TTCATTCATCGGAGGAGCAACATTTGCCGTTCTTGGTTGCAGAGCTATTTCCAGTGAGGTGTTTAATCTCATGCCAGTCGGAATTTCTTGCACGCTTCAG
CGTTCTCAGATGCGTTTGACCGCGAACACCGAAGCAAGCGCACGAATGCATTTGTCTATAAATGATCGACGCCCATCATCGCTTTCCACTGGAAAACGGT
TTAAAAGATCAAGGAGCAGCGAGAGTTATGGTCGTGCTGGAAGCAACGTCCGAGATCACTTTCAAATTTGCTTAAGTTTGCTTCATACTACCCGCATTTG
GTTTCCTGTTTCTCCGGCCACAATGCACTTCGCAACGGTTCTCACTGCTGTTCTTGCCGCTGTCACCGTCGACAGTGCATCGGCCTCAAGCTGCGCCACT
GCGTCTCAACTGAAGGTCATGAGCTTCAATCTTCGCACGTCGATTGCCAACGACCCGTGTCCGAGTGGGTGCTGGGAACAACGCAAGTGGCGTGCTAAGC
AActcgtggagaagtacgAGCCTGATCTCATCGGCACTCAAGAGGGAGCCCCCGACCAAATCCAGTTTTTCCAGGATCAACTTTCGTACGCAAGCACTGG
CGAGTGTGCGGGTGATTGTCAGTGGAACGAACGCGACAGCATCTTCTACAAAGCGAGTCGCTGGGAATTGCTGGAAACATCCACCTTCGCTTTGGTACGT
TCATGGGCGTAGGGTCTCATTTGAGTTTTACAGACGCAACTAATCGTTTGGTTTCTCAACAGAGCGACACTCCCGACGTGCTGCCGTCAAACACGTGGGG
TCTCCAGTaccttcgtgctgcagtcaTCGCGCGCTTCCGCGATAAGACCAGCAGTCGTGTCGTGTGCATGCTGAACACGCACTTCGACATCACCCTCGGT
CAACCCCAGTCATCCGTGCTGGTCGCTCAACGATTGAGCCAGCACTGCCAGTCGGAAGACACGGTGCTCATGACTGGAGACCTGAATACTGTCCCTCAGA
GCTCAGCCGTCCAGTACCTCGCCAAGGAGGGTCCGATTGATGGGGGCTACACACCGATCCCGATGTACGACACGTTgactgctgcaggtgccggCGGACC
TACTTGGATCGGTTCTTCCTTCGGGAACTACCCAGCAGGCGCTAAGTATGACTACATTTTCTCACGCCGCGACGACCACACTTGCCTTCGCAACGGCACG
ATCTTGGTTGACACGTTTGGAGGCTACTCCAGCTCGGACCACGCCGTGCCATTGTCTGAATTCTGTCTAGGAACaaagtgctcgagctgcatcGCCTAGT
TGTTGTGCGAGTACAACACAGCTTTCAGGATAGCAGTGTTTCACGTTCGCGATCAATGGATACTGTACCTTTAAGATGAGCTGCAACGTTGCTTTATACA
CAATTGGGAATCGCTCTGACGGCTTGTCCAGGTGGATTACCTTCCTCGTTCCGAGTTTTGCCTCGGACCAAAGTGCCCCGTGCCGGTTGAAATGAGATAA
CTGCCCGATATCTTCTTCTCAATTGAACTCAAGAATGAAGGGTAGCACGGATGCGtccgtgcagctccttgtgCTTTCCTTCATCTGCTTCTGTTGTCCT
GGTCTGCTCAATGCGCTGACTTCCTTTGCTAGTGGGTTGGCTGATCCAGCAGTTGCATATCGTGGCAATGTTATCGTGTATCTGAGCTTCGCGAGCTGTA
GTTTACTAGTGGCGGCACGTCCGGTTGGCTTTAATTTTGGGGTCCGGAGGCTACGTTTGCTACGCGGCGGCACTGTACCATCTCCAAGCACAAGTGATCG
ATGCATCGCTGAAGGTTTACTATGCGGCCTGCGCAGCTTTGGGACTTTCGGCTGGATTTCTGTGGACAACTCAAGGCCGAATGGTCATGAGCTACGCTAC
GTCGGAGAACCAAGGCTCATACCTCAGTACGTTCTGGATAATTTTCAACTTGGGTGCAGCCGCCGGAGGATTCGTCAGCGTCGCTCTGAATTTCTCCCGT
GAcgagcttcctgctgccCACGGGGGGACAACAGAGCACGCGTCGGGAATGATGTACGCTGTATTTATTATTCTCATGATCGCTGGtgttcttctcgctg
ctttTGGCATCGTTGACACGGATCAAGTGGTTCGAGAGGACGGCACAACACCTGCCGACAATTTTCGAGCAAACGAACCCAGGAAGCCGTGGTGGACGGA
GATACGTCGGCAGTTAATCACCGCAAGAACGAACCAGCTACACGCGGTGGTGTGTCTGCTGCCTCTTTTTGCGTACAGCAATTGGTTCTACACGTATCAC
TCCTTTTTCAACGTGACTGTGTTCAATATGCGGTCGAGTGGGCTCGTGAGTTCATTCTACTGGCTCGCTCAGATGGGTGCCGCGTATGCTGTCGGCCGGG
CTCTCGACACTCAAGTCTTCAAGAAGACAAACCTACATCAGACACGCAGTCCAGGCTCAGCACGGGTGGTTGCCTCGGCTGTGGCAGATGTGGGAGTACG
GTCGCTGATTCTtttcacgctgctggcaaACGCGACGTGGGCTGTCGGGTGGCATTTGCAGTTGTCGCTGAATTTGACATACGAGAGCTCGCTAAACCTC
GATGTCATCGCAGACTTTCCGTCCTTCCTCCCTCCATTCCTGCTTTATGTAGTCTACGGCTGGAACGATGCACTGTGTTAAGTCTGGATATACTGGTACA
TGGGTTCGCTTGCTGGCCGAGACTCGACGGCTTGCGGCCATTTCGCGGGGGGCTACAAAGGTGTGCAAGCTATCAGTGTGGCAGTCGCGTGGCACATCGG
CGCGGCGAAAACGGACCCACAGATCCAACTCGTTGTAAATTGGCTGCTCTGTAATATCGCGATGCTTGGTGCGTATACTTCCGTGGTCTCCTTCTGTGCC
AGTAGGGACGATGCGGAAGTTCAACCTCTGCTTGGTTCGGAGGCTTTACCTCCATTGCAAACTCTGTCTGCTGGGTCATCACGAGATCTCCGCAGAGCGT
AGAAGACAATGAAGTGCAGTTGCAAGTTATTTGTTTCGACGCGTCAAAGAATTCTTGCAATCTGTATTTGCATTTTAGTGCTGCTTTTGGTACTTTGTCG
TTGTAAGGTGTGAAGTTACAACGACGCCGACAAACCAAGCTGTACTTGCACACCCTGCGTGGTCCTGTCTTGCTTGGCATCTTCACGTCCAATGCAGTTG
GAGCACTGCGATCCCAGGCAGAACTCAGAAATCGGAACCGCGTGGTCGGAGCTAGAGAACCCGTCGTACAAATCAACCAGCACCGACGCGTTCTGTAGAC
ACGTCTCCG