Description :
From Genome Similarity Track
Location :
Scaffold_59:18897- 35373
Transcript NameFunction/comments
Phyag_g1367conserved hypothetical protein
Phyag_g1368hypothetical protein PHYSODRAFT_439222
Phyag_g1369hypothetical protein
Phyag_g1370hypothetical protein PHYSODRAFT_561955
Phyag_g1371hypothetical protein
Phyag_g1372hypothetical protein
Phyag_g1373hypothetical protein PHYSODRAFT_286559
Phyag_g1374transcription initiation factor IIB, putative

Sequence
16476 bases(100 bases per row)
CGGCGTGGGGGAAGGCTTCCAGACAGCGAGGCGGGGACGCTACGACTCGATCAGACTCGCTACCTCCAGATGCTTGGCGGGCACTCCAACGTTCGAATAT
GACTCTCCTATTGGCTGAAAAATATCAGCCTTATAACCAATAGAAAAGGCCTATTGCATCCGATTAAGTACGAGCGaatccgacagcttcaaacagcgaa
gagctccagatgacgatggcggcgcCGGAGCGAGAGCCCTCGGTGGCCACTGCAGCGATCAAGTGGCGTATAGGAGAGCGACAACTGCCTCGTTCACGTC
ACGAAATAGCTCCACGTGGTTTACTAGCGAAGGAGACGCACCCATTGGCTCTTGCAACGACTTTTTCCAGTCCCGGACAGCACGACTCGTTCAATTCCGC
GACTGCATTCGGACTTCCACTcagctctgcgtcttcagcacttggTGACTCTTTCTCCAATAGGAAAAGCGGTGGTGCAGTGTCTCcagagctcgtcgtg
ctgcaagATGGAGACGTGGACCCTCTGGGTGTCCTTGGAATGTCAGGGAATGCGAAGACGGTAGATACTGAGGCTGCACACTCGAAATCTGCGTCAATTA
ACGAGGTCCAGGACGGCAAAAGACGCAGTAATGCTGGTGCAATACCCAGTACTGTTAAATACAAGTGGAAGGAGCACACGGACCGATTGTTGGCCAAGTA
TGCGGACCACACGTTCAAGATCAAAGCGAGCATGCTCGAAGTGAACGACCTGGAGAGCGAGATTTCATTCGCGCCGAAGAGCGATTACCAGAAGgagcaa
gatggcgctgAGGTGTCGGTGATCAAGAAAACGCGCGCTCGACTGGAACAATTGGAGCGAGATCCCAACAAAACTGGGTCTCCTACTTCTTCCGAGCAAA
ACGAGCAAACGATCGAACTCTCGCAGAGCCAATACGTAGCTAAAGTAAAGGAAATGCAGAAGAGACTGGTCGCAAGTTGGGAGCAGAACCACAAGGTGGA
GGCGCTGAGGATTGCGATTAAGTGCGTAAAACTGCTTGCTGACATCGACACGGCGCCTCAGTTGTACCCGTGCGTGTTCGTGTTGGTGAGTGAAGTGCTG
GATACATTTGGCAAACTTGTGTTCGATCGTATCCACGCACGAGCCTCCGAAGATGAAAGCGGCCAACCTCTTCCGGAGCCGCTAAGTGAGAATTTTATGA
GCTCCGACGTCAATATCCAAGCCACCGAAACGTGTCGCAATTGGTTTTACAAGACAGCGTGCATTCGAGAACTTCTCCCGCGAATGTACGTGTTTGAAAG
GCTTATAGTGGTTAGCAAGTTTATTGCCTGATGagtgtttgttgttgtacAGCTACATTGAGATTGCACTCCTCGGGTGCTATCGTTTTCTTTGTGATGG
CGAGTATCCACAGATTGTTGCACGGCTATCAAACATGATCAAGTAAGATAACTCTGCAGAAGACTTGACTTGTGGTGAGCATGCCAAGAATCATGCGTCT
AACGTTATGTTATGTATTGCTGACAACTTGTTGCAGGGGCGTTGGCGAGCCGATGGTCGCATTGTACGCGCGCCTGTACCTGGCGTTAACCAGTTCGGAA
CTATTAGGCGCCACGTCACCAGCAGATCAAACGATTGTAGTCAACAGCAGCCTGTTCGACTACTTTTACGCATTCAACTGGTTCCGCCAACACAAACTTG
AGCACTGGTTGCTCACCCACAAAATGGAGCGCGACGATTATttggcgctgcactcgcCTGCTGTGGAATGGCTGGTCAAATGCGTAGCTCCAGGGGCCAC
CCAGGACACGTTCAACACCTTATTGGCGCACTATCAAAAATATtccgacagctccatggTGCTGAAGCACTTGTGCGAGTGCTTTGGCGCTCAATTTTAC
GCATCAGCACCCACTGATATGTTGGATTTGATTCGCACAGCGTCGCCATCACTTGTGTCGAACTGTCATCTTTACAGTCTCGTGGCAGTGCAGCTTAGCA
ATTCTCCGGTGATCGCAGATAATGAAGCAGGAGGAAAGCTGCAGTTTTTGAACGATTCCTGGTCGTCCATCACTTCCCAGGAAGACATCGCGCAGTATAT
GGAGTGTGCGGCGGCTTACATGAAGCTCATTGTGGCTCATTTCTCGGTACGCTACGTGTTGGTGATCGCCAGTTTTACGGGGTTTTACCTGCAGGAAGTG
CTAATGTTAGTGTTCTGGTGTTAGCATCGAGAGGCTCTCATCCTGCTTAAAGACGTCGTGCGCCACCTTAACTCGGCAACACCCGACGAGCTGACGGCAA
AAACGTACAACCTGCTTGGTGCGTTGATTGAAAATGTTGTCTTCGGTGCCAAGCAGCATTACGAGTTTTTCTCGAAGCTCATCCCATCGATGTCTTTCTT
GGTAAGTGCGCTGTAATCTCATTGCTTACCATTTTGACACTAACTTGAATATTTTATTGATCTTCAGGCTCTCATGGGCATGTTCAAACGGGAGTCAAGC
GTGGATGTGGCGAAGAAAGTGTTGCGAGCTTTTGTGGGGGGCAATATGAAGAAATCGTCTAACCGATCCGGCACCTTACGGCTCCACGTTGTGGGACCCG
AGGCAGCCGTGGCACACACACTTTTGGTTGTATGCTGTCGTGTTCACGATGCGCTTGACTCTCTCAGTACTGCTTCCGAGCGCGCTGAAGCTACCCGCGA
TATATCGGCATTCATTACGCGACTTGGGTACGTAAATGAGACAATGACTGCAAGTGagcgagctcaagacgaggAGCAAGAGGCATTACTCATGCTCTAC
ACAGATTGTCGTCGTTCATTCTACAAGTTGGAGCCGATCAAAGTGCTGCTCTCCACGATGGTTCTTCGGCTAGCGATGCACGTTCACAAGCGTATCGGTG
CCAGCGTTGCATCTGTGATCGGGGGCAAGAGGCGTGTTCATTCCCGACGGAACTTTATTCAGTCGTGCTTGGCGTTCGCACACATCACGATTCCGTCAAT
TGAGGCTCCGCTAGAAAAGTTGCAGCTCATGGTATCCGCAGCGAACGTCGCGTTGGTGACGAGCTGCACTCCGCAGATGGATGCGTTGGTGAAAGCTGCA
ATTGTGCTGCTCGCAGATCTAGACCCAAGCGCTCTTCATTCTGGTATGAGTGAGGACCCGGATAGTATGCGGTTCAACACGCCAagtcgtgctggtgctg
tcggcCTATTTGGCGCAGTGGGCATCGATAGCGCCAGCAACATCATCAACCAGATCGTGCAAGTGATCGCTCAGTTGATGAGCGTGTTGGTGTATGCGCC
ATCgctcaacgacgaagacgcgtTCTACTTTGTGTCTGCACTACACAAAGCTGTGTTTGAGCGTATGACGTGGGTGTCACCGAGTTCGTCCTCGCTAACC
CATCGACTCGAAGCTGGCGTCGCTCGTGTGCGCGTGCTCTTCATGCTTGTCCAGTTGTATGCTCTGTGGGGGCAGAGATCCCTACCAGGTCGTCTACAAG
GGGTTGACTCGAACGACGTGCTCtacggtgaagacgacgcgttCTACAACGAAGTGCAGGCACGCTTCAGTGCGACAGTTGAAGAAGTGGTGCGTGAAAT
CGATGCATTGGGGGAGACAAACGAAGACAATGACAGTGTGGGAAAGCAAGGAGTTGCAGCGCAGGTCGAACTCATGCTGGACTTTGTCAACCTGGTGGTC
TCCGTGCTCGAATTCGACGAATCTCGACTGGAAGGGGCTCTCACCACCACAGATCCCCGTTCTGCAGAGGAGGGTGTTGGCAGTCGACGTCGTAAAAAGC
CTCGCTCCGGAGCTGCATTGGTGCGAAAGTGTATGACGTACAGCCATGACAAAGCACGGTCGCTGAAGCAGACCAACCCGAGAGAGCTGTCGACGAGTCA
AGTGCAGATGACCACGTGGACCTGCCGCTATTTTGACAGTTCGCGCATGTACGTCGCGGATTTCATGCAGGGGATGTCCAAGCGCCTTCGATTGGATGCG
AGCAGCCAACAGACCGTCCAAGCTGTAGCGGAAGCGCTCAGGAACCTTGCGCTGTAGGGAGTGTGCCGTAGCATATTTTGCAGCGTGGAGTACAGGAGCT
GATTGCAATGAATGGCCCATACCATCCCCGCCATTGATGCCGCTAGGCCttcgaagttgctgccgaaTGGCTAGCACCACACTTTTCGGCTTGGTCGCGC
CACCGAATgtgtcaacttcaacttgcgaCCTTTCAAGATTGATCAGtccatacaaaaaccaagtggTTTCAGCCGTTACAGATAACGGACGTCCCTTGCC
ATCCGTCTTCTCCGTCCCAGCCCAGCGGTCATTGACCGGCACAGCGCTGTTGGCCTCATTCTCCGATTTCCAGCTCGCAGCTCAAGCTcctctccagcac
caagcaaACTCCACCACTCCGATAACCATGGGCAAGGGCAAGGGCAAAGACAAGGACGCTAAGGATGACAAGACGGCCGCCAAGGATGGTGCGTCACCGc
tcgcgttgctgttgtgaGTGTTGTTGCTCTGTGGCTGACGCTGTCGtgtgcgtgcagcttccaaggacgagaagggcggcaagaagggcgGAAAGAAGGG
AGGCAAGAAGTAACCTACGAGTTTCTAGTCCCAATCCTTGAGGCCTGTCGGTCTGCGTCAATTAGCAGCATGCGAGGTTCTCGCTAACCAGAGCCGAGTG
GTCTAACGCTTCGGCCGAAGCCACTCAAATATACTATGATTTTACCATTCTCATTGCATTGCTCTCGTGTTTTTTGTATAAATAGTTGGCACACTCGTAA
AGCCTCATAGTAGGCGTGCTTGATTTAGAGCCACAGTGCGTCCTTGTCTTGTTCATTGTCGGTATGCCGGAAGATGTCCGTGCTGCATCACCGACAACGC
CATCACCAACAGGTAGATTTCGCTTGAGGACACATGAGCTGGTGCCTGTGTTGCTCCCAAgatctcgaacagcttcttcaccttcgcctAGACAGGGGTT
TAATGCTGTGGTGCCTTCTAGACCGCGAAACTTGACTGCAAAAGCTACCAGTCCGTCTCGTGGCCGTTCAGTGCTGGAGTCCGTCGCGTTTGACCCTTTC
AGTGGTGCTGAGAGCTTtcagctgctgttgcagaacCCCGAGACTAGTAGCACAAGACGAGAAGACCCGAGAGCAATAGCGGACTTCCGACAATGGATAT
GGCAGCATTTCCCACAACTAGTGAGCACGTTTCAAGCGCTGCGTATGGTCAACACAAAGATGACAGAGCCATGCCAACAGGACCTTCCGAACACATTTGC
TCTTCATGATGAACCATTTACCAACCAATGCAGAttcgacgagatcgaagaAAAGGAGGCTGAAATCGAGCAGGGTACCGACGAGGCTTGGCGACTCATG
CTCCGATACGCGACCGTGTTGTCAGCGGCACCCGGTGAGAACATCGCAACCCAGAGTTTGACACGCACCGAAAGCGTTTACTTCCTGCTCAATGGACACT
GCGAGCTCTCGTTTCGACCAGTGCTCGTGCGAGACGAAGGCAAAACGCCGTCGCCTCCATCATTGCTTCCAAGGATACCTGGTGGAGTAATTCGATCTGG
TGATCATCCGGTCATACTGCTACGAGAGCTTGCAGCAGGAGATTATTTTGGACTTGACGCTGGCACGTTCGGGTTTGAATACCTTCTATCCACCGTGACA
GCGGGCAGTGCACGGCAACGGAACGTTCTTGGCCTCCGTGAAGCGACCTTATCTCACGTGTTGCGTCTGCCGTACCAGGTCGTTCAACAGCTCCAATTTC
TCCAGTGCCGACATCAAAATGGCGGTGATCGGCTACTTCCAGGCTTCCCATACTCGTTCTCGCCGGACGCAGAGGTGTTTCTGCGCAACACTTTCCTCTT
TCGAAGTATGCCCACCTCGGCCCGACAATTTCTAGCGGCGCATTTGCAGTCTGTTGTCGTTTCCCAGCAAGAGTATCTCTTCACACCGGGCCAACCTGTG
CGGGTGTTCATCGTGGTCAGCGGACAACTCACTCTCGGAGCCCCTCGCGAGGAAAACCGTGGCGTGCAGAAAGAAGCTGAtctggagctggaactgctgc
aagcTCATGATTCAGTCGGACTAGCGGAGGCATTGCGCTTGGCACCATCCTTTGATCGGTATTGTGTCGTGACATCAGCTTATGGCGCACGGGTCTTCGC
GTTGCCCACCacggtgctgctcatggctCTGGCACAAGAATCAACATCGGTGAAGCTGGTTCACGAGTGGATCGCTCAGCGAAAGTCCTGGTTCGAGTTG
CGGAGAGCCACAGCATTAGCTCAGCGCAAGAGATTCACAGCTGAAGGCTCCGAGCACGTAGTACGATTAACCTTGGCAACACAGCGACGAAGTAAGTTGA
CGTGTTCGCGCTGCGGTTGGGCCGGGCACGTATCCACTTCATCTGCGTGTGTGCACGTGAATATCACATCAGTCAGCGAatttgcagcttcaccaaTGCC
CCAGCAGGATGTAAGAGGGAAGAAGTCGCTGGAAGGTAGCCGAGCAGCGAGGCAACAGGCACGAAACTCGCAACGTCAATCTCAACACCACTCTGGAGAC
AGCGAGGTCATGCCTGTTCCCCAGCAACTCTCTCCAACCATCCCAACCAGCCCAGTTGGTCGATTTAGCTTACTCAGGTCGCCCGCACATCGAAGGCTGA
AGGTCGATTCAATAGCGCTCCGAGCACTGCAAATATCAAGATTCTCCATTGTCGCTGATCCCCTTCAATCCTACGATGTCACTGGCCATGGAGCCGACAC
GCAGGAGGTTCCGACCAAAAGCAGTAAGAACGATGCACTCCGCAGTATCAAGCTAACACAGTCCTTCCAACGACTCGAAGCAGCACTACAACACAATGAA
CCTCCATCTGTATAGCAAGGCAGAATGTAATTCGCAAGCACTTCACAACAGTTCATGAATTACCTGCTCCAcgttcagcagcactgcGTGGCTGTGGCCG
GGTATTATCTGCGCCGCCGCTTCTTGTCCCTACTGCTCTTGGATCTCCGAGAGTTGCTCATCTTCTGCTTGCCCAGAGCACCTTTAAGCGGCTCAAAAAC
GCTTTGGCCGAGACCGAAATGCTTGTCTTCATTGTACGCCGTCCcgtggagttggtggagatgccGCCGATGGTAGTACGCGATTGGAATGGCCGGCACA
TAGCTCGGTTTATCAAATTCATTCTTCGGAAGCGCGACGCCAGCAAGATCACTGTCGTCAGGAAACTCAACACTCGGACTTTGCACACTAAAGACATCAA
CGGGGGCAAGCTTTGCAGCTTCGGTGAGCTTTTCCTTCTCGTGCTTTCGCTCTTCCGCGTCATGGTCAAACACCTCCAGATGCAATTCGTTGTCAGTGAT
GAGACGAAAGCCCGCTGGATACATCGCTCCTGGCCACGTAGTGGTGAATTGTTCCTCAAGCACGTGCAGATTCCCACTAGTGGAGACAGCTAGCACGCTC
TGTCTTGTGCGGTCCCAAGCTAGCGCCAGCACGCCATCTTTTACCCCGACGTTGTGTTGGGCCGTTGTCTTCCCCAGAGCAGACGCTCGATGCCATGTGA
ATAAACCGTTTTCGCCTACATGCCGATGGCGCACTACAGGTGTACCAACCACAAACTCCTCGCCACCGCTAAAGCAGCAAACCGCCCAAGGTGCGCGCAC
TGCACCAGTCGAGTGGAGTGCGATCTCGCGCAGCCCTAATGGGTGTTCTTCTGTAGCAGTAGCGGACACTTCTTCTGAGCTTGCATTTCCCACAGCAGAG
TCCACGACAAACTCGTGAATCCCCTTCGAACTGGTGAGCAACATTGCTGATTCACGCAAATTCACACACAGATCCACGAACTGGATTATGACATTCAACT
TGAGACTGTCAAGACACTGCAACGTCGCAGCATCTAGCACCGCCAGCGTCGATTTGGAGGTGGCGCAGTAGATGCGCTTCCCCGAACGTCCATATCGCGC
ACAGGACGCGAGCGTCGGGTGTCGAGAGTTGCTttgtggcgttggctggGTGACCTCTGAGTTTTCCAGCGGAACATTTTCCAGCTCCGTGCGTTCGCCA
GATACAACATCCAATAGCACAGGACGGGAATTCCAAAAACTAACGACAACCAGCTTCGGGTCACAAGGGTGTGCACTCAAGGCGGTAATGGTGCCGTCAA
ACCGGAACGCCGAAACGAGCGTAGCTGCCTCCACGTTCCAGACACATAATCTCGCTCGACGTGTGGATTTCTCCTCACAGCCTGCAAAGAGCCACCGCGA
GTTGCACGACCACGCACACTGCGAGACCACTTTCAACGCTGTTTTCACCACTCGAAGATCCGCTAAGGTCAAGGAAACGCcaccatctgcagcgtctgct
tcGTCCTCTGTTTTGGTCTCTTCGCTctcgtcttctgcttcagcagcgtctccctcttcctccgtcgctgcgtcctcctccacagACGCCGCATCTTCCg
tcttttcctcctcctcctcctcttcatcttccatcGACGCGTCATCGTTCTCGACGGACCCCTCAGCCTGTGCATCCGTCTTGTTGGTCTTCTtcccttc
ctcctccgtcttggccgTCGGATCAACCTCTTTGTCACCTGTTGGAGACTCCACAGCCGGCAGCGCAATGAGCGTCGGGTCCAGCTCCCGCGTGATGACG
CGTATGCTCGTATTGTCCCAGATGGTGACGCGCCCTTCGCGCTCGCCCACCGCGATGAGCGTCTGAGGAGCGTTGAGCGCTAGACAATTGGCCTGCTGCG
TGTCCTCCAGGCAGCTCCAGGACGACGTCGGACGCGACAAAAGGTGCTTCTGCAGatagtcgtcgtcatcgtcggtTTCTTCTACGTACGCCACTTCATT
ATTGACCTCTGGAGGCTTGTTATCGTCCTTAGAAGCGGCAGGAGCTGCGGGGTCATGTGGGTTGTCGCcttcagctgctggttgtgaGGCTTCTGCAGGG
AGTTCGGCGCTCGGAGTCACGGCGTTCGAAGCAGAAGACAACGCAGAAGCAGCCTGCGCGAGTTGTTGCCGCCGACGCTCCTGATGCTGCCGCTCCCCAG
CGTGCACAATGCGGCGCAGCGCCTGGTTCCACATCCTTCGTAAATAGTTATCTCCAATCTAGAACTAGAGAGACATGCACTTTACAGATTTGAAATGGTA
TACTTTAAAAAATGACGCGCTGCGCAACCTATCTGCAAAACCGCAATCTTATCTATGCTTCATAAAGTATCCAAACCTATATATATAAGACAACTTCTAC
AATAATCAAGATCCCCCCTtcaatgaagaaggcgatgaagACTGCAGGCTTGCTGGCCGAGAAGTTGACGTACCCGGCCGTGCGCCGCGGCGACCTAGTG
GAGACTTTGCACGGCGTGCAGGTGGCGGACCCGTACCGCTGGCTGGAGGACCCGGACGCGCCCGAGACGCGCGAGTtcgtgacgcagcagaacGACGTGA
CGCAGGGCGCGTTGGCCAAGATGCCGTTCGTGGCGGAGACCAAGGCGCGCATGACGGAATTGTTCAACTACGAGAAGTTCTCGGCGCCGAGTAAACACGG
AGGCAAgtacgtcttctccaagaacgaCGGCCTGCAGAACCAGAGCGTTCTGTACATccaggacgagctgcgcggGGAGCCTCGCGTGCTTCTGGACCCC
AATCTACTGGCGGAGGACGGCACCGCTGCGCTCTCCAGTCGCGCCTTCTCGGAGGCCAAACTGGAGGACGgcaagctcttcttcgcccACGGAATCTCCC
GCGGGGGCTCGGATTGGCAGACGATCAAAGTGATGGCGGTGCACGACGGCCACAAGATGTTGGAGGATACGGTGGAGTGGgtcaagttctccagcatcgc
ctGGACTCATGATGACAAGGGGTTCTTCTACTCCCGATACCCACCgccggagaagatgaaggacgaCAAGCACGACGATGCAGAAGGCCCTAAAAGAGGC
ACTGAGACGGACACCAACATGAACCACCAGCTCTGGTACCATACGTTGCACACGCCGCAGTCCGAGGATAAGTTGGTGTACGCGTACCCGAGTGAACCGA
CGTTTAATGTCGGTGCTGAGGTCTCTGAtgacggcaagaagctgctgctttaCGTGCAGGACGGGTGCAAGAACGCCAACATGATCCACGTCGCAGACTT
GGGCGACTTTGACAACTTCCTGAAGGGACCAAGCGACTCGACTATCCCCGTGAAGAAACTCGTGGACAATATGGACGCAGCGTACTCATACATTCTGAAC
GACGGCGAGTACTACTACTTTAAGACCAATGCCGATGCGCCTCGTGAACGTGTAGTGCGCACCAAACtgagcgacgacagcgcTGCCCCCGTGTGGGAAG
AGGTGATCCCAGAACAACCAGACGCTATCGTAATCGAAGGCGTGCACCCTGTGGCACCGAACCTCTTAGTCGTGCAGCTTGTCAAGGACGTGCACAATGA
ACTGCACGTGTACAACCTCGACGGCGTATTCCAGTACGAGATCCCGTTGCCCAGTGTGGGCACTGTCGGTGTGGCCAGCAAGCGCACCGAGTCCGAGCTG
TTTTACCACTTCATCTCGTTCCTGTACCCGGGGTCTATCTTCCGCATTGACCTCTCCAGCTCGACTCCAGGATCACCGCCTGATGCTGAGCTCTTCCGTG
AGACCAAGGTAAAGGACTTTGACCCAAGTCAGTTCGAGGCGGAGCAAGTATTCTACCCATCCAAGGACGGCACGAAGATTCCAATGTTCCTTGTCAAGCG
TAAGAATGCGCCCAAGAATGGTGAACTGCCAGTGTACCTGTACGGCTATGGCGGCTTTAACATCTCGCTCACGCCGGCCTTCAGCGTCTCGCGCCTTGTG
TTTGTCCAGCACTTTAATGGCATGCTGGCGCTGCCCAACCTGCGCGGTGGCGGTGAATACGGTGAGCAATGGCACCAGGATGGTATGCTGCACAAGAAGC
AAAATGTGTTTGACGATTTCCACGGCGCAGCCGAGTACCTTATCAAGGAAGGCTACACGAACCCAGAAAAGATCGCTATCCACGGTGGATCCAATGGCGG
TCTGCTGGTGGCTGCTACCAGTAACCAGCGTCCCGACCTGTACCGTTGCGTGGTGGGTGCTGTGGGCGTCATGGACATGCTGCGCTTTCACAAGTTCACC
ATTGGCCACGCATGGCGCACGGACTACGGTGATCCGGACGTGGCTGACGACTTCAATTACATTCGGCGCTACTCACCCGTCCACAACGTACCACAAGCCG
ATAGCCCCATCATGCAGAAGCTCGCTGAGCGCGGTGGTTTCCCGTCAGTGCTCCTGACTACGGGCGACCATGACGATCGTGTTGTGCCACTGCACTCGTA
CAAGCTCATTGcagaactgcagcaccaactcggTAACTCGGAGGCACAGACGAACCCTCTGCTCATCCGCATTGACACGAAGTCTGGCCACGGAGCTGGC
AAGCCCACCACCAAGATTATTGAGGAGACGTCCGAGGTGTTTGCTTTCATCGCGTGGAACCTCGGTGCTCCTTTCGTTGCTTAAGGTGGGTGGGTAGTGA
ACTCCCCCTGTGCTGCTTTCATTTTATGAGAACGGTTGCGTGGTGCTTCCTTTGGTTATCATTGACTTGGTAGGACTCATGAATGCATCAATAAAATACT
TGGCTTCTCCTTAGCACTCGCCATACGTCTTGTTCGTAGATTGACGCCGATGCCAACCACTACAGGCGTTTTACAGAGTTTCGAGAGCCTCCTCGGTGGC
CGTATCAAGGACAGCTCTGCACGCCAACATTGCGTCGGGGGCGCATAATATGCTCACTGGTAAACTGCCCTCGAACTGAAGCCGTATCTTGTCGGTAGGG
CCAAGCTCGTATGTGTTGGAGCCTTGAACTCGCATCGTGCACTCCATAGCTTTTTGTAACGCCAGGAACGCGTCACTAATTTGGTCACTCGTCAGCAATG
AGAAGCCTCGCTCCACACTCGACACCAGTTCCTTGATCCCCGACACCGCCTCGTCAAACAACGGAGGTGGTAATGCCTTCAACGTTGCTTGAATAGGCTT
GAAAAGGGCGCTGTCCATCACCGTGAAGTCCGGGGAATACGGCGGGAGGCACTGCATCTGGATGTTCCAGCCCTCCTTGCGCCCTTCTTCAGCGAACATC
GCATCACCAAGGCATCGGATCTTCGCACTGTCTTGCTGAATGTAAATGGGGTTTTGCATAAGATGAATCGGCATCTTCGCTCGAATAGCGGGGATAATGC
ATTCCGTGATCATGCGCTGTACATCGTCCTTCGTCACCGTTTCGAGTGCCACAACCGGCTCTGGAAATtgctgcggcggcttcgTGTCTGCATCCTCTGT
CTGCGCCTCTTCTCTCACAAAGGGCCACGTGCCAATCTTGCCGTCAAAGTACTCGTTCTTGTGCGGATCCCATTGAGGTctcgccaccgccgccatgaaC
ATAactttcttctttttgtcCCTCGGCAGCGAGAACCACTTCAAATTGACGTGCACAACGTTGTGCATGTCCTCGAACAACCCATTGGGTCGCACTTTAT
CAGCACAATACCTTAGCCGCTCCAGTTTGTTCTTGTCCGTGAGCGACGGCTTGATCGAGTTGATAGTTGGACTTCcgtcctccttcagcagctcgtacag
cgtcgtcttcggaaTACCAACTGCAGTTGCCAGTGCGCGGATAGAGCCTCGTTGGGCCAATGGGATTTCCTTCacgcgctccagctccgccgacCAGTCG
CGCTTGCGTCGACCGCGACGTCCGACCTTCCTCGACGCGATGTCGCACACCTCGTCACCGTTCTCCAGACTTTGCACCGCGCGCTTCCAGAGCCTCGAGA
CGGTGCGACGGTCCACGCCGAACTCGGTGGCTGCGTCGGTGACGGCATGACGCACGAGCTTCGTGGTGCCTTCAACGCGTCTCTTGAGCAGGAAGTCCAG
CATGGCGCGACGCTCGTCGTACGTcaagttcctgctgccgcGCTCCTTCCACGCGCTGGTCTTCTTGTCGGAAGCGCGGGTGGGGCTCTCTGCTGAGGCT
TCGGTCTCTGCAGCAACGGAGAGAAGGACCTCCGGCATGGGCTCGGTAGGTGCAGCAGCGGGAATCGGCGCAAGCTCCATTGACGATAATCAAAATGAGT
GGAGACAGTTCGAACGGGACGCAGGAAAATTCGGAGCTTTTTATTCGCAGAAAAGCGGATTGATGCCCCTTTGATGCCCCCTTTTACCTTGTGTGGTGCA
CATAaatcaacttcaacatgatgttgaagcacGTGGTTACTCAGATGGCGTGTCCAGCGCAGACTGACAGGCTAGCAACGCCTCGCGCTTGCACAAGACG
CTCACGGGTAGACTGCCGTCGATCTGCAGACTCCTTTTGGTTGTATCTTCTTGCGAAGCGAAGTCATTCGAACCTCCCGTCAGCATAACGCactccatcg
tcttctgcaAAGCCAAAAACGCGTCGTCGATCTGTTGCGTGGGGAGGACGGCGAATGTGCGCTCCACGCCCGCAATGAGTTCTTCCACGGGAGACAGCTG
CACAGCGACGCCACGAAGTCGCAGAGGAGTCGTCTCCGGATAAATATTTTTGAGAAAGTTGTGGTCTAGCACGACCAGCTCGGGGCTGTAAGCTGGCTGG
TACTGCACTCGGATGTTCCAGCCGTCTGTGTTGCCGTGTTCCGCTATGACAGGGTCGTCGACTGTTAGTCGCATCTGTTGGCTGTCAAATTGGATGAGCA
CTGGCCTGTTTCGCAGCGAGCTTGGCATCTTTGCTTTAATCGCTGGGATGACGTGGTTCGTGACCATAGCTTGAATCTCTTTCTTGGTAATCGTCTCCAG
TACGCGGAACGCGCACCCGATCTGAGAAGCTGCTTGGTCCCAAGCAAACACGTTAGATTCAGCGCACGTTCCCAGTGGTAAGGGTGGATCTGCTACCACG
AAAGGCCAGACACCTAGCTTCCCgtcaaactgctgctgccgtcctTCATCCCATTGCGGTCGAGTGACAGCAACGAGGATCATGACTTTATTTTTCTTCG
CTTCGCGATTGCCCGACAGCGAGCACCACTTGGTGTTGATGTGCACCATGTTGAACATGTCGTCGAACGCTCCATTTGGCTGCACCTTGCTGTAGCAGAA
CCGCAGTCGCTCCCGCTTATTCTTATCGGACAGTGCCGGTTTGATCGCATTGGCAATGATAGGCTTGGCCTCGCTATTGGTCTCTTGGTTATCATCTGCA
TCTGTGCTGCCAGAGGGAGGGGGGTCTTCGTTACGAAGGAGGCGGAAGAGTGTAGTGCGTGGGACGCCCACCGCCGACGACAGAGCTCGGAGCGAACCAC
GCTGACTCAACGGCAGCTGCTTCACTCGCTCCAGTGCAGCCGAGTagtctttcttcttgcgtcCGCAGTTGCCGCGTTTCTTGGACAGTGCCTGCTTCAT
CACGACCTCAGTGGATGCTCCGGcatccagcgccgccttcatGAGACTCCAGACGCGCGACACAGTATTGCGGTGCACCTGGAATCTGTCAGCTGCAGCG
GTGATGACTGAACGCGGCAAACGGGCCTCGCCCTGGCTGTGGTTGAGCAAGAAGTCGGCCATGACGAGgcgctcctcgtccgtcatgTTGGGTTTGCGTC
GACCCTGCGCTTTATTGTCCGGAGGAGTATCAGGCGGTTGAGTGGCATCGTCTGGGAGCTGATGATCTGGCGCAAAGGTGGAGGCCACCGGAATCGGCTC
AAGACTCGCCATGGCAACGGCGGCACCTGCTAAATGATCACCTTCTGACTGAACCATCTATTCTGGCCATTACatcatttcagccaatcaacGTCGCTTT
CGTGTCCTGAAAAGAATGTGTCCATCTCAATTGAAGCGTCATAGAAAATCGAGTTACAATGCTCAAGTACCAGAAGTGGCTCGCTGCGTTCGTCGTGTTG
CTcgcgctgtggctgctgctactgcggTACGCGGCTGACCAGGTGCAGGACCCGCGtgtgctgcaggtggtgacGGCGTTGCCCATGTACGCGCTCGTGT
CCTTCGGCGCGTACTCGCTGGCGACCATCGCGCTGTCGGTGATGGCGGTGCAAGACTTCCCCGAGgcggccaaggagctggaccgGCAAGTGACGGAGGC
GAAGGCTGATCTGGCCAAGAAAGGGTTCAAGTTTTAGAGGTGGATAGCCAAGACAGAAGGCAGTGGAGAGCAAGATATGTGAGATGCTGGCTGGACGGCA
ATAACCTGGCTACAGAGCAAGATGTACGGATCGGATCGCAGTAATTCGAGGACCAGTGTGATCGCAAGACAGCAGGCTAGCTGGTTGTGCTGCGAGATCG
TCTCCAAGTTACTGTCGTTACGAGGTGCAGAGGTGAGAAGAGCAGCGTcggaagcagcttcgtgtcGTCCTGCCTGTTAGATTTAATAAATGTGATGTGT
CCACATATAAAGTGCTTATTgtggtgtggtgtacacgGATGTTCCGAGGTTTTGAGGTTTTTCAGGTCGGTGGATCGCATTAGTTTCACATTAGCGGCGG
CGggtgcagctcctggagcCATTTGCAGGCGCGTGGTGCGACTGGCAGGCGGCAATCGACGTGGGTGGACGGCGCATTCGATTCTCCATCCCCTGCTCTC
TCGATCGCACTGCGATTCTTCCCAATTGACCCAGTATCGACGGCCCTAGCTGCTTCTTTCTACAGCAGCCACTTGACTATGGGCGGCGAGTGCGTGCCGG
ATCATTGCCGCGAGTGCGGGAGCGCGGACGTCGTGACGGACTTCAGCGCGGGCGACGTCGTGTGCCGCAGCTGCGGCATGATCCTCGGTGAGCGCATAAT
AGATGATTCCCCCGAATGGCGAACGTTTGCTAATGATGACCGGGGTGGTGACCCCGCTGCGAAATCCAGGGTCGGCGACGTCGCGGACGCACGGCTGAAC
AGCCTCTCGCTGTCCACGTATCTGGTCGACCCGAAGAAGGGCGGCGGGGGCGCCGACGGAGAGCCCGGACGCAAGCACAAGCGCCCCAACATTTCGTCCG
ACTGCGCCAAGGTCAAGAGGATGCAGCGCAACATGACGCGCATCCAAGAAGTCGCAGATTATCTGTCGCTGCCCAAGAAGATTGTGGAGATTGCGTTGGA
CGTATACGCCGAAGCGGAGAAGCAGGGGGTCAGTATGAGAGGGCCTGAACGAGAAAGTATGgcagttgcagtgctgtTTATTGCGTGCAGGAAGGCTGGC
AATGCCCGATCTCTGAAGGAGTTTGAAGAAGCGTCTGGCATCCCTAAGCGACGCATCGGCAAGTCCTTTATGAGTTTGCAGCGTCGATTGGATCTCGAAG
TGAAACAGGCGACGACAGAGGAATATGTGCAGCGCTTCTGCTCGAGACTGGGGCTGCCCAGCAAGACGCAGATGAT