Description :
From Genome Similarity Track
Location :
Scaffold_66:188909- 191546
Transcript NameFunction/comments
Physo_138743hypothetical protein
Physo_138744Short-chain dehydrogenase/reductase SDR
Physo_109166glutamine amidotransferase

Sequence
2637 bases(100 bases per row)
AAGATGCCCCCAATTATCATTGCGCCGTTCGTGTCCCTCCCGATCCTAGCCGAGTATATGGCGCTTGTGAGGAAGACCCTCGCCCATGTTGCTAGCTCCT
CTTCGGGTATGCGTCACATAATGTTATTGCTGTCCTGACCTGTAGCTAACCCAATCTGCTGTGGGTTCTGCAGTTATGACTTGTGAGCCAGCGTTGAAGT
TGCTACCGAAAATCGTGGACGACCACGTAGCGCTGTCGATCTTCCGGAAAGCTTTTGATAGCGAAGTCGCAAGCATGAAGCCTGGCGAGGTGCGTTTGAA
TGAATTCATTCAGTGATGCTAGAGCGTTCATAGCTGACAAACATGTATCGTCGCAGGAGCGTCAAATGAAGTTCCAGCAGCTTGTGCTCAGGATGTGGCC
GTCGTTTGTGCACTGGCAAGAACATCTCCCTCCTTCCCTCCTGCCTCAAGTCAAGCTACCAGGCGCAACGCAGAACTCGAAAGCTCCCGCAGGTGTTCCA
CCCAAAGGCGTGAGTGCGGCTGAAAATTCTGCGACCATCGTGAACGACCAGGTCGCGACCCAAATGCGACTCAACTTGCTGCAGACCACAGCTTCCGGGT
ACGTCACGTGCCAAATGCATGAACAAAAGCATAGGCGAAGAATCACTAACGCCTACGGAATTTTCCTTCAAGCAAACTGCGTCTGCAAGATGTCCGCGTG
ACGTCGACACCGTTCCACGTCCGCGAGGTCGCGTTTCGCCGCTTGTTGTAGGCTGTAGGCTGTCGGTAAGTGTATATGTACAAGTACTACCCATAGTAGT
CTTCAATATCTACTCATCTTCGTAACAAGTCGTCAATCATGTGATACCAAGACAATTGCAAACAAAAGGTATAGATTAACTCGGGCTAATCCGTGTGCAC
CAAGTCAAAGAGCTAGAGCATGAGTGAACCCCCTGCTCAACACTACCACGCCAGCAACAAGATTCTACCACGGCAGCGCGTCGCCCTTCTCGAAGTGAAA
CATCTGCAGCTTGTCGTCCACGTTGGCGCGCTCGATGATGCGCACCATGCCGGCAACACTGTCCTCAGGCGACACAATGCCCGTGAAGTTGACGATGGCA
GTGTTGACGTAGGGTGCAGCAGCAGGCAGCCGATCTTCTCCGACTTGAGGTCCAGCGCCAGGCTCTGCGTGACCATGTTGAGCGCGGTCTTGGACGCCCG
GTAGCCGTACGAACCGCCCGATCCGTTGTCAACGATGCTTCCCATGCGCGACGTGATCTGCGCCACGAAGGCCTCGCCGTGGGCCGCCACCGCAAGGCGG
AGGTTGGGCAGGAAGGCGCGCGTCATGAGGAAAGGGCCCACGGTGTTCACCTCGAACTGGCGCATCATGTCCTCCTTGGTGGTGACGTCCAGGCCGCCGC
CGATGGAGATGCCGCTGTTGTTGATGAGCACATCGAGAGCCACGCCCTTGAGCGCCTTAGCGGCAGACGAGATCGACTGCTCGTCGCCCGTGTCGAGCGT
GATTGTCTTCCAGGGCTGGAGACGCTGGAGCTCCTCGGCCGCGTCCACGTTACGCGCAGAGGCCACGACGTTCCATCCTTGCTTGACGTAGTGCCGCGCG
AAGGCCAGGCCGATGCCGCGGTTGCTGCCGGTGATGAGCACCGTCTTGAGAGGAGACTTGACCGAGGACTAAATAAAATAGTCCCGATCCAAAATATAGT
CCCGGAGACCATCACTCACTTCCCGTTTTGGTCCGTTTTTTGGTCCGCAGACTTTTTTGGTCCTGACTTGGCGTTTGTATGCACCTTAGGAAAAATGTGG
CTCGCGCCCCGTGAGACACTCCCGCGCATCATTTTGACTTGACTTTGTAAGCAGGAGCCTTAGGAGCTGTGGCACGGTACGTTTTGTACACCACACTTAT
GTTACTTCAGAGCCCGTCGACGCACACTTGTTCGATAGCATGTCGCTCGGGAACCGCGCGGACCCGGAAGCCGCTGCGCAGGACGAGGGCGACTGGGCCG
CGAGAGACGACGATGACGCCGTATTAGTGTCACCAGGTGCACAGGACGCAGTAGCGCCGCCTGCGTCCTCCAACGGCCAGGTAGAGGCCCCCTCTGACGC
TCAGGAGGACGCCACTCGCGCCGCCGACCTCGCCGTGCTGGGCGACGCCTGCCCGATCTGCCTGCAGACGCTGGAGGACCCCGTGATGCTAACGGGTTGC
TACCACGTGTACTGCTTCGAGTGCCTGAGCACGTGGGTGCACAGCTTGGCGCTGCACGGCGTGGAGCCGGCCACCTGTCCACTGTGCAAGGCTGCGTTCC
AAGAGGTGTACGCTAACGTGCGCAGCGAGACGGACTTCGAGGTGTTCCGCTTCCAGGGGCGGCAGATCCAGGACCAGCAGAGCAGGAACAGGCGGAGAGA
AGAGAATGACAGCAACCGCCAGAGACTCAGACGCCGCTCGCTGGTGTATCGACGCCACATGAGACTCGTCCGAGTGGCGGGCGTGGAGGTGAAGGACTCG
CACTCGTTCCCCAAGATGCACAAGGTCAAGGGCGAGTACGAGGCCTGGCTCCAGAGAGAGCTGCGGGCGTGTATCGGCCGGGATATTGACCTCACCGTGC
TGCTGGCGATCATCCAGTGCTGCCTCAACAAGATCGC