Description :
From Genome Similarity Track
Location :
Scaffold_165:1889- 4941
Sequence
3052 bases(100 bases per row)
ACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGGGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTTACCGC
GACGCCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGTCGGAGGTGCCCTCGTACGAGTACGAGTACTCGG
CGCCTCCCGAACGCCACTCTCGTCCGAGTGCTCCGGCTGCGGGTCCGACAAAGGGCCCTGAGGTTGACCGCCTCCGTCAGCGTGTCCTCATGCTGGATAT
TGCACTTGGCCTTGGGACTGGCGGTGATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGCCGCCTGGACCTGTTGGAGCGAGAG
GTCGCGAGCCTGCATCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGGTCCGACGGATCGAGGCTCTGCTGCCACGTT
CGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTACGGAGC
CCCTCCGACGTACGGTCTTGACCGCAGCCTTGCCGTTCCGACCGAGGCTTGGGTGCCTGCTCCGACGCTCTCGTCGACGTCTGCGACCGGCCCTCGCTTC
GAGGAGCTGGGTCAAGGTGGGTCTGCGAGTCAGCAACCCCGTGCGGGTCAAAGTACCGCTTGAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGA
CTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACA
GTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCACCAATCTCAAATATACTTAAGTTTCCTCTTCCTTGTTTGTCCGAGTACCCCTTTTGTT
TATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCAC
ATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTTCTCGAAGAGTGAGAGGCACTCTGGGGTGACGG
AAGCCGTTCACGTAGAACGGCGTGAACCCCGTAGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTGCGTTGTG
CTGCCGCGCACACACTGCGCCGAGTGTCTTCGAGCACTCGATTGACGCGCTCTGTCTGGCCGTCTGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACG
AGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCCGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACG
CCATCAACGAACAACCTTGCGGTTTGTTCGCCCGTCACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTC
CGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGA
AGAGTGCCCTGCGGGTTTAACCCGCTGACATGTTTCACATGTCTTGACGTACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACC
GACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTTCGCGAGGATGTCGAGCTTCAGATCCTCGTCGTTGGGTACGACCA
CCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGA
CTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACC
CGTGTGATGTGGGCCAACTCATAGTCGGGACGCCTAGAGAGGGCGTCCGCAAGCACGTTGAGCTCGCCCGGCTTGTACTCGACGCGGAAGTTATATTCCG
CGAAGAAGGACAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCGTAGA
GCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCTG
GACTGGAATGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTC
GTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCT
TCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTG
GGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGGACTTTGATCTCTGGT
GACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGTATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCT
TGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAGTTGCGTCACCAGGCGATTGAGCGT
CGCCGGGGCGTTAGACAAGCCCTGCGGCATGACAAGCCACTCCCTAAGTGTG