Description :
From Genome Similarity Track
Location :
Scaffold_1789:1889- 3405
Transcript NameFunction/comments
Phyta_totarag13657hypothetical protein PHYSODRAFT_313518

Sequence
1516 bases(100 bases per row)
GACGACTGACGTGGCCTAGAGGACGAGTTCTTGGcggctcgtcgtcgatcaaTGCGATGATATATAACCGAGCACCTACGACGACTGGCAAAAGGCTGGA
GCTAAAATGGCTGGAGCTATGCGGACTGTTTACCGTATTTCAAGAAGTCGCAGACACATGACCTAGGTGCGGACGACTAtcgtggtggagacggaCCACT
GAAGGTGACGAGGAGGTTGCAACGAGACCAACCGTTGTACCAGGCGATTATTGATGCTGCGGTTCAAGCAGGTTATCCGTTCACGGAGGATGTGAACGGG
TATCAACAGGAAGGTGTGGGGTGGCTGGATCTGACGATCCATGAAGGGGAGAGATGCAGCGCCTCTGCTGCGTATTTGACACAGTCTGTTCTGGCTCGAC
AGAATTTGACGGTTCTTACGGATACGTTCGTGAACAAGTTGGTGTTTGAAGGGAAGAAGGCTGTGGGCATTGAGGTGGAACCTTTCAAGGCATCGACAGA
GCAACCAGCGACGCAAATTCGAGCGCTGAAAGAGGTGATTTTGTCGAGCGGTGCCATCAATTCGCCGCAATTATTGATGTTGTCGGGTGTGGGAGACGCC
GACCGGCTGAAGGAAGTTGGTGTGCCCGTTGTGCACCATCTCCCTGCTGTCGGGCAAAACATGGAGGAACACCTTGGCGTATATCTGCATGTCACGTGCA
AGAAGCCTATCACACTTTACCACGCGACGCCGCACTTCCCACACAAGATGCTGTGGACGGGGATCAAGTGGCTCACCTCAAAGTCAGGCCCCGGCACCTC
GTCACACGTTGAAGCAGGCGGGTTCTTCTGAAGTGAGCCAGGTAAGCGCCACCCCGACATGAAATGGCAATTTCTTCCTGGCGCGAGTGATGAAAaccgc
cagcttctgctcgatgGCCATGCCATGATGCTACACTGCACTCCACTACGCGCGACGAGCCGAGGATACATCAAGTTGCGACGCGCAAACCCGCGGGAAA
GTCCCACCGTCCAACCCAACTATCTGGCCACTAAGACCGATCACGTGGACCTTCGCAACGGCGTGCGGTTGACACGCGAAGTCCTCAAGCAACAAGCATT
TGACGAGTTTCGCGGCGACGCAGTCTCCCCGACTGATCAGGTGCAGTCGGATGCTGAGATTGACGCGTGGATCCGACAACATGCTAGCACGGACTACCAC
CCATCGAGCACCAATCGCATGGGCAAGGAGACGGACGCAAGTTCAGTCGTGGATGCTCAGACGCGAGTATACGGATTGGAAGGGCTGCGAATCGTGGACG
CATCGATCATGCCGAACAACGTGAGTGGAAATCTCAACGCGCCGACCATCAtgctggccgagaaggctGCTGACATCATCCTTGGCTAACCGGCGATGCC
CATGGCCGACGCTCCTGTGTACGAATCTAAGAAGTGGGAGACAAGTCAACGGTGAGTCAACGATGAAGTTCACGTCGCTGGGAAACGTGTTTGGCAGTTG
GAAGCGTTGGTCAATG