Description :
From Genome Similarity Track
Location :
scaffold_26:188895- 191117
Sequence
2222 bases(100 bases per row)
CCCCACTTACATCGGAGACACTACTCATCGACTAAGCGGTAATCTTGGGTGTCGTAAGCCATTCAAAAAAATGGCGTGAATCCTGTAGATGAAATACCCA
ACTTGTTTATAGTAAACTCAACCAATGGTAATAACGAACTTCATTCTATGAGATGTTCCGCACAGAATTTTCTAAACACATCACCAACCAAAAAACACGG
TTAGAATGTTCCGTTTGCTCATCGATCTCCGGGTATACCGCTGTGGACATATCCAAGCGAGTGCCCAGAAATCAatacaacttttcaaaatcagtttgTG
AATCTTGTATCACGATCAGAGGCGATGGCGTCTGGTAAGCCGTGCTTGCATAAATATGATTAACGAACCTTCAGTATCGATGGCGAAGCAAtgcaaacca
tcttgctgagtctgCCAACAAAGACGAGCACCCCATTATGACCATCAGCATTCTCGAGCAAGCCAAAGATGAAGTCGAGATCGATTGACTTCCAACAGTC
AGTACGAACAAGAAGCCTTTGCAGTGGCACCTGTGTGTGCCGTGCGCTCTTCATGCGCTGACAGACATTGcatgtcttcacgtatcgTTCCACCCACTTG
TACATATGGGGCCGCCAAAATGGTGCACTGAGAGACTGGTAAGTTTTCTCACGGCCAAAGTGACCGGCTATCGGCGTATGATGTGTCTCTTACACTATCC
TAtacttcaaatcatcgttgtgGAGAACCTCAATCCGTGGCTCGTCGTCATGTGCAACTTCATAGTGAAGAGAGCACCATTCCATGCGTAACGATGCAAC
CATGATTTCAAGAGACCAGGAAGCATGTCATGAAACTCTATTTGACTCGATGACAGTGCTATGATTAACAGATCACACTGTTCATCCTCAACATACGCTC
GAGTTATAATATCGAATATATCGTTTTCGATATATATGATATGAGCCAGCATAAAATCaggacgacgtgacaatgcgTCTGCCGGTACTTTCGGTTTCCC
TGGCTTGTTCGAAACCGTGTAGTTGTATATTGCGGAGAATAACAACCAGCGAGTCATTTGCTGTGCTAAGTGAGACGACTGAACTGCACAACACAAGCTT
GAGTGATCCATGTAGACGATAATTGGAGTTGAACACAGGAGGTGAAAATGAAATTTTAACAAAGCATATTTCATTGCCAGAAAGTCTTCGTAGAGGAAAC
AGTTGTTTCTCTCTGCTGGCTTCAGCTGTCTCAATTGCTATAACACGACACGACCGTGTCTTCTTTAGTCGTTCTGCAATAATGCACAACCGATTGCAAA
tttgaagcgtcacacaccACGCTTAACGGCTTTGTATCATCTGGTAAAGCAAGTTATTGTGCTTTAACCAAGCTATTCTTGATTTGAGTGGTGCTTCTTC
ACAGATGAATGACCACTCCCACGGTACGTCCTTCTTTAGCAAATTCGATAGTTGTCGTACCATTTCCGCGTAGTTACGCGAGAGCGATTCAGGTGATTGG
ACAAACCAATCCATTTCCTCAAATCCATCTGGTTCCTTGCGTCGGCCTTTTCAAGGTCTGCACGAAATCCATGTTAACCAACATAACAACAAAGAGCCGG
TACTTCATTAGCATCAAAAATACACTTTGCAAAAATCTCTTGCAAAAACCGTTCACTAATACATTCTAGCACCGCACGAAGGTGCTCCAAGTGCACTTCT
GCGGCAGATCTGCTATCTTTGTCCTTAAATGAACGAAAATATTGTCAAAGTATAATTGTGCAAAGCGTCGCAGTTGTCGGAACAGATGTGAGACAAATCA
ATTGAATGTTGTTAGGACATTGCATAgaccttgtggcatcacaaacgtTGTGCTATCAGCTGTCAAAGGGACTTTCTTCTCCCTCATCAAAATTGAGTAA
TATTTATTGACCAAATCAAGTACACTAAACTGTATACAGCCGGACATCCGGTGGATGGTGACATCTTTACGCGAAATTGGCATTTCCGCGTAAATCGTCT
GTGCATTCAAATTGTTATAGGAGTGAACGATATGCTATTAACCGTTTGGTTAACGCACACAAAAAGCAGGCGTGCTGTGAGGGACTTGCACTCCCTTACT
AAACCAGCAGATTGCTTTTAAGCAGAGAACTTATCGACATACTCGCTTTTTGCTCCGGCGaaagtggccactgtcgaagCACTGCATGCTTTAGAACAAA
TTCACGATCAATTTCGTGTCGA