Description :
From Genome Similarity Track
Location :
Scaffold_765:18888- 20748
Transcript NameFunction/comments
Phypl_g10848hypothetical protein PHYSODRAFT_486085

Sequence
1860 bases(100 bases per row)
CGCCCGCCGTGGCATCGCCCGCAGACGCGTacaccttctgcagcgccgggttggccacgccctccagctccttctgcttcgactcgtactcctccttctc
cgacGACTGGTGCGCGTCCAGCCACTGGATCACCTCCGTCACcttgtcgtccaccaccttcttgtCGGCCTCCgggatcttctccttcagcttctcgtcg
ttcAGACTGTTGCGCAGGCTGTACGCGTagttctccagcgcgttctTCGCCTCGATACGCACCTtgttggcctcgtcctccgacttgtacttctcggcct
ccgccACCATGCGGTCGATCTCGGCCTGCGAGAGACGGCCCTTGTCGTTCGTGATCGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCCACGGCCGACAC
GTTCAGGATGCCATTCGCGTCGATGTCGAACGTTACGTCGACCTGCGGCACGCCGCGAGGCATGGGCGGGAGGCCGTCCAGATTGAACTTGCCCAGAAGA
TGGTTATCGCGCGTCATGGTCCGTTCGCCCTCGAACACTTGGATCAACACGCCGGGCTGGTTGTCTGCGTACGTCGAGAATGTCTGCGACTTCTTGGTCG
GCACCGTCGTGTTACGGGCGATCAGCGTCGTCATGACACCACCGGCCGTCTCCAGCCCCAGTGACAACGGcgcgacgtccagcagcagcaggtcctgcag
cttctccgaCGATTCGTTGCCGCTCAGGATGGCCGCCTGGACGGTAGCCCCGTAGGCGACAGCCTCATCGGGGTTGATCGACTTGTTGGGCTCCTTGCCG
TTGAAGAAgtccgacagcagctgctgcaccttgggGATACGCGTCGAGccgcccacgagcacgacCTCCTGCACCTGGCTCTTGGAcagcttggcgtcgc
gcagcaccttTTCCACGGGCTCCATCGTCTTGCGGAAGTAGTCGCCGCACAGGTCCtcgaagcgcgcgcgcgtgatggtcgagttgaagtccacgccgtc
gaacaGCGAGTCGATCTCGATGTACGCctgcgccgacgacgacagcgtaCGCTTGGCTCGCTCGCATGCCGTACGCAGAcgacgcagcgcgcgctggttC
TGCGCCAGGTCCTTGCGGTGCTTGCGCTTGAACTCCTGCACGAAGTACTCGACGAGGCGGTTGTCGAAGTCTTCGCCGCCCAGATGCGTGTCGCCCGCCG
TGGCCTTCACCTCGAAGATGCCCTCCTcgatgctcagcagcgacacatcgaaggtgccgccgcccaggtcgaagatgaggacgttgcgctcgccgccCTT
CTTGTCCAGGCCGTacgcgatggcggcggccgtcggCTCGTTGATGATACGCAGCACGTTGAGgccggcgatggcgccgGCGTCCTTGGTGGCCTGGCGC
TGCGAGTCGTTGAAGTAGGCCGGCACCGTGATGACGGCGTTCTTGACCTCCTTGCCGATGAaggcctcggccacctcgcgcaTCTTGATCagcaccatgg
acgagatctcCTCGGGCTGGAACGTCTTGGACTCGCCCTTGAACTGCACCGTGATCTGCGGCTTGTCGCCGGCGCCCGACGTCAGCTTGAACGGCCAGTG
CTTGATGTCGGACTGGACGATGGGGTCCGAGAACTTGCGGCCGATGAggcgcttggcgtcgaacaCCGTGTTGTGGGCGTTCATGGCCACCTggttcttg
gcggcgtcgccgaTGAGGCGCTCCGTGTCCGTGAAGGCCACGTACGATGGCGTGGTGCGGTTGCCCTGGTCGTTGGCGATGATCTCCACGCGGTCGTTCT
GCCACACGCCCACGCACGAGTAGGTCGTGCCCAGGTCGATGCCGACCGAGTGTCCAGACG