Description :
From Genome Similarity Track
Location :
Scaffold_57:18885- 19970
Transcript NameFunction/comments
Hyaar_Emoy2806900Arf1, ARF family GTPase

Sequence
1085 bases(100 bases per row)
TATTGCCGAAAATCTGTAAAACAAATCAACCAGTACACTATTTGATATTGTGTCGTGTATAAGCTCGTAAAACAAAATTTTTTTATAAAATAAGCGTAAA
ACACGCTAATTACAATCATAATAACTTATATCAGTGAGCATGGGATTTGGGTACGGTGCAGTGTTTCGTTGGGTACGGTCCAGACAAACCCCCAGGCTTG
TATGATGATATTCACCTTTGATCGATTTAAGCCAATAACGTGCGTGGGTCACAATTATGACCTAGTCAAAGAGTGACTTCAAATATTCCTATATAGCTAT
GAAGGGTGAAAGGCTAGATCGCACTTAGTTGGACGTGTAAGGCACACCTAGCAATATTTATACACACAGACACACACATACCGACATGTTCGATTTAAAA
AGTTCGGCATTCACCTTGCGTACCGTCACTAATAGCTTACCATTCGGGATTGCAATGAACTACATCTATGTATGGTAACGTCTTGCTCACCAGCTATTGC
GCGCATCAAGCAGCGATTGGTCGGTTGATATTAGGTCGATATTAACATATGAGCGGATCTTGGGTCACCCAAACAAATATACCATGAACAGTAAACTTTG
TGAAGAGAATATTAAACATGATATCCTTTTATAATTGTATTTGATTTGAAAATATTATGCAGCAGGGTCACCCCGTTACATCCCTTGGGTTAACAATGGA
GTATAAACACTGTAGATTGCTCACCAGAGTTTCAAATTGGGCGCCCACGCCCATGCCCATGGTTTGTTATGGTCATGGGTGCGACCGAAAATTGGTGGGT
GGGCGTGGGTGGGCGCGACGTCGCAAGCTTATATTATTTAGCACCATAATTGGTAATAATTTTATTGAGGGAGCCGCTAATAAGCCTTCACTCTTCACTA
ATGAGCCTTCACCCCATACATTAATCAGGTAACTCGTTTTGAAACCGCCTAAATTGTCAATCTGTTTTTTTGTACTACTATGCTTCTAATTTCTAAATTT
TCATAGTTAAGACTGAGCCAGTCATATCCGCAGCTCCACATAGAGCAGCCCCTCCGACGAGTGAGAGCACTTGAAATATAGGCTC