Description :
From Genome Similarity Track
Location :
Scaffold_72:188831- 190230
Sequence
1399 bases(100 bases per row)
TCTTGATGTCTCTAAGACCGCGTCGTCCACGACGGATGAGGCGTTCCACTCCTCCTCATGTCCCAGCAGGATCACCTCGGCAAGCTCGCCTGCCTTCAAG
GTTTCGCCAAACTCGGCATAGCCATCTCGTCCAGCTCTAGCACCGCCGCTCCACGTACGCCCTCAGGGCAAACAGCAACCGCGTTGCTAACGCTTTCTGA
CATACCATTGTCCAGCACTACGGCCGCCTCGTCCTCGTGCTCGCGCCAAAAGCGCTTCTGCTTCCTAGCAGACGTGGTTCATGACTCACCTAAGCTTCAC
TAGGAGCAGGGTGCGACGCACCCAACGTTTTCGACTTCAAGTCGAGCCATGGCGCTTGGCGCTCCAGCCATGCCATGCCAAGGATGAGGTTATACCTCGC
ATCCAGGGCTAAGCCCAAACAGCGTTCCATGCTATCGAAGTTATCAAACTTCACTCCAAGGTCGGCAGAGACGTTCGACACAGTTACCAGTGTCCCCGTC
GCGAGGCGGACAGAGATCGTATCTCTCGTTGGCACTTCCAGTGCCTCAGCATACAGCTGACTCCCTTCCCGGGTGGAGCGACGGGCGTAGTTGCCCGAGG
CCCCCGAGTCAATCAAGCTTCCCCATGGCTTTGCAAAGCCCTTCACGTTCGCTTGAACGACCAGCAAGCTTGGCTTGTACACACACTTCTCGTAGGAGAG
CTCAGCTCTGTTCGGGGCTGAGCCCCGTTGTCCTCTACCCCCTCGAGGCACAACAGAACTCAGTTCTTTACTAGTAGGCCGCCCCGCGCCTACTGGGGGT
TGCCGTTTCCCGGCGATGGCCCGGCGGGCTGGCTCGCCGGAGCCTCGCGCTTAGGAGCAGTAGCGTCATTGCTGCGGTGCTCCGCCTCCCGAGGAACGCC
ATCCTCATCGTGGCGATGTTCTTCTTCTCGAGGAGTACCACCCTGTTTGTGGCTGTACTCTTCTTGGAGGGCGATTCGAATCGCCTCCTCCATCGTTGTC
GCTTACATCCGGAATAGCTGGGTGCGAGCAGGACCAACCTTCAGGCCGTCCATCAAGACTGTTGTCTTGATGACTTCAGGCAGAGGATTCCCTGTCAGAG
ATGCCACCAACGTGTGCATCTCTACCACGCACTCCCGCAGCTCACATTTACCTCGCTTATACGCGAGAAAGCGAGCGCTGGCGGAACGCGGCACGAAGCT
GTTCACACTGCTGATCCCAGGATGCAAAGCATCCAGAGATGTCATCTCCCTGGTGTATGCCCAGTGCTTGGCACGTCCACCAAGGTTGGACAGGGAAAAC
GCCACCCGAAGTGGCTCGACCGAGATGAGACCCGCCTTCATGGCGATCTCCACCTCACGGACCCAGAAGTGAAGGTTCTCTCCTTCAAATGCAGGGACC