Description :
From Genome Similarity Track
Location :
Scaffold_350:18883- 20509
Sequence
1626 bases(100 bases per row)
ACCCGTGATATTCTGCCTCTTTCACTATTCATCCAGTACCAAAACGCGACGAGGACGACAGTATTGTCCACTCGGGTAGTTTCCATATCACTGTGCTGTA
AGGGCCCACTTTTTTCTTAATACGTGCTGACCCATCAAAGCTGACGACCAGAAGCACTTCGCCATGTCTGACCGTAAGGGAAGGCATACTGGTGGTTTGT
CTCGGTTCGATTTCGATCAATATCTTATCCGCCTCCTCCCGTGGTGTAATACTTGCTGCGAGGATGCCGAGGATCTCGTCTTCCCCTTTGCTACACCGGC
TAATCTCCAACGTCCAAGTCACAGTAAGGCAGCCCATCTCCCAAGTATTTCGTTAAGACCCGATGACTGCATCAACCACGCCAAAGTCGAGTTCCTATTG
AGCACAATAATGTCCCGCGAGACCAATACCGTATAGCAAATATCCATTATCCGGAGCAGGGACAGAACTTCCTTCTCCACCACTCCGTTATTGATTTCAT
TAGGTTTAACGTTCGACTTGTGAACAGGACAGGTCAATTTATTCCATCTTCAATGAACCGGCTGTAGTAATTCAGGTTTTATAGGAAGGACTGCATTGAC
TGCAATGTCTGGGGAAAGGAATATTCACCAACGACCCCAGATCCTTCGGGTCAGCTTCGATTCTCTCTATTGACACCTGATGCCCGAGGTACTCAACCTT
GACGCTTTTTAGGTAGGCTGAGCGACAAATTACACTGATCCCATACTTCCAACAACCTGTCCACCTTTTGATAAAGAGACGTCCAGGATTATGCTGGGAT
TAGAATGCCATCAATGTAGGACCTCCATTTTAGAACCGAAGGACTTCGGTGTGGGTTTGGATCGCCGTCTGTAAACACATCAACCTGTTGAGACACCCCG
TGGTCACTTGGCTTCCGCCGATCCCCGATCATAAGATACACATAAAAGGCTTTATCCACCATACGCTGATATATATGCGGCGTGTTCTCCAGCCCGAACG
GCATGCGTAACCATTCATACAGACCTGACGGCGTGATAAAAGCAGAGCTCATTCATTCTCTTTCCGTCATCTTCGCAACCTAGAATCCGCTGGCCATATC
CAATGAACAGAACCATAGCGCTTTGTCCAGATCCTGCACCAAGTCGATGATCAGAGGCATGGGGTATACCATCAGCCTCGTTAATTGATTAACTCTTCGG
TAGTCTTTACACAGTTGTACATCCACCCCATTCTTTTTCACAATCACTCCGATTGGCGACGCCAATGGCGAAGTTGAGGGACATATGATTCTTGCCGATA
GTAACCCTTTGATCAGGTCCGCCAACTTTTCACCGAACTTTGGGGCGACTAGCCTTACTCGCTGTGCGACTAGGGCTGCTTCTCCGACATCTATATCGCA
AATTAAACCTCGCGCAACAGGGGGGGGGGCGTTTCTTTTACCCATCAAAAGGTGCTGTTTCTTCCAGATAAGCTGACGTAATTCCTCTTGCTCCTTGGTC
AATCGTACTCCTGGGTCGCCTACCTGTATATCGTCAAATTTCACGTCGCTCAGCATCACGTCTACTCTGGTAAGTCTGCCATGTGTTGGCCAACATCTTC
CGTGAATAACACTCCACTTTCGTAAT