Description :
From Genome Similarity Track
Location :
Scaffold_411:1888- 5757
Transcript NameFunction/comments
g15366.t1hypothetical protein

Sequence
3869 bases(100 bases per row)
TGATCGTGAACTCCACCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCTTAGCTCTTCATGGTATCAACCAACACGCGGTTGACACGTTCGGT
TTGTCCGTCGGTATGAGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTTTACACATCTTGTGAGACCGTGGTGTCTAAACACCAGGTC
AACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTC
CTCCGCTTGTTGTCTTGCTGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGT
TGGGCGCAGGCTTCACGCGCTGACATACCTCGCGAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAA
GTATGTCTTCTCGCGGCCAGGATGTCCCGATGTTGGGGCATCGTGATACTCATACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGA
TCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGAGTACGAAGGTGTTTGGCCAGCTTCTGACGAGACT
TGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGT
CGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAGAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTG
TACTCAACCTGGAAGTTGTATTCCGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTAGTCGCCGTACGCAACGATGCGTGGT
CGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGACTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATT
GCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATAGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGAT
GCATCGCACACCACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAGGGCCTGCTGACAAT
CAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAG
TCCAAGGAACTGCCGCAGTTCTTGTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGACGTTCTTCCCCACG
AGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTTGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAGCTTGCGGAGAT
GCTCTGTATGCATCTCCACATCCGACCTCCAATTCACAGCCCGGCTGTGAATGAACACATCGTCTAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAA
CAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCT
GTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCAAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCA
CATCTTTTCGAGGTATCGGCGTCTGCGCCACCCGCCCTGTGGCTTCTTGACACAGAACGTAGGCGAGCTGTTCGGGGACTTCGATTCCCGCACTTGTCCT
GCTTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGACAGTGGCCACTGCTGCGTGACGCAATACTTCGTTCCCGGCACGAGAT
CAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGC
CTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGATGATTCAGCTCTTCTGCT
TCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCAAGCGAAACGCTTCCAGCTTGTGACTGGGAGCG
ACATCAACTCCGACGCTAACGTCGGAGGATTCTCCAGTCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAGTGTCTCGACGGT
CGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTTTCGGTCCCTGACCGAGACTTGCGCAGCTTTGATTGCTTGCGCCGTTCACTTCTC
GTGTGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTT
CAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACTGTCCGTACTACT
TGCAGCGTCGGCTCCCAGAGCCGACGCACCTTCTTTACCACTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACACGACCGCGTCGCTCC
GGACGCTTCAAGACCCTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGATTTACATTTCCTTCCAACGACTCTCGCAGTCGTTGACGTTCGCTTGGG
GTGATCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGAGCCGTATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCG
CTGCTGCTGCTCCCGAAGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATGATATCGAACTTATCGTCCAGTTCGAGGACGATAAGCTCGTCGAC
GAACTCCTTCTCTTGATATGATAAGCGGACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGT
GTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTT
CGAGCTTACCTTCAGGATGACAAGGTTCGGCTTATCATCTTGCTTCTTGCAGTGATAGTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCA
ATGTCGACACGCTCGACCGTATCACCAGCAGGGCGCCCCGCGCCCTACTAGTCGCTCTAGTTTTTGTATTGCCCGTGACGATACCCAGTATCGCCACGAT
GGCTCTTCGCCGCGTGCACAGGTGCTGTGCACTCGCAGGCGTAGTGACCGATGTGTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTG
AGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTCACCACCGGTCGTGGCATCAGCCGCGGGGCGTTCACGTGCCGT
TTAACCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTTGACAC