Description :
From Genome Similarity Track
Location :
Scaffold_1500:1888- 3848
Sequence
1960 bases(100 bases per row)
CGAGCCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGGTCCGAAGACAGGAAGCCCCTGTGAACGTGAAGGCTCGG
GATCCAGTAGGCCCTACGCGTGATCTGACACAATCCATCCAGGATGGAGCCAGACCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTA
ATCGCCTCACGGACCCTGTCTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGATACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAG
TCGGTTTCTGACCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGAGA
GACAACTTCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCTA
TGATCCAGAGGGTACGGATCTCAGCCATATCGGACCTGAAGGAGTTAACGGGCAAGGATCACGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAA
GTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTGTGCGGATCTCCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGC
CGGATCTGGCTCGATCCTGGCTGGATTGTGTCAAATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCACCGGGGCTTCCTGTCCTCGGATCCT
CGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCAGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTT
GAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCG
CGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCTTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGAC
TGCCACCAACTTGTTCGCCGTTTTCGTTGGAGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGC
AGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTT
GCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAATCGGTGAATC
TGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGA
TAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCA
GCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACC
AAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAAC
GGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTT
CAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAA