Description :
From Genome Similarity Track
Location :
Scaffold_1515:1888- 3365
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_1515-abinit-gene-0.5Gene of unknown function

Sequence
1477 bases(100 bases per row)
TCGGCGTCAAGTGATGGCCAATCCTGAAGTAAAGTGACGACTAGAAAAAGAAGATTGCGACCGGTGAATCTGATGGCGAGCGACTGAACGTGCGGGTTCG
ATTCGTACGGGACTGTGTCTGATTGAGATAGTAACGACTTCGAACATGCATACCGCACTGATGTGAACTCGTATAGAGCCGACGTACTGAGGCCTACCGG
ATCATTGGAATGTGGTGAGATCGAACTTACCGGTGATGCGAGGCTGGATGTCAGGATGAGCTGAAATGTGGAGATCAGCTTGGTCAAGATAATAGAGCCG
CTCTGGCCAGCGGTGATCAATCTCCTGCACAAAGTCGTCCACGTTCACCACGCTGGTAGACGGGGGAAATACGGCGATCCCGGTTCTGACAAGCCGCATG
AGCGCTGGCTCGAGGAGGACGTCAACGTCCACGAGCCCAGACAGAGTCAGTGGGAGGAGTCCTTTCGTGAGGTGGAGCCATCGATCTGTAACGTGGGAGT
TACGCTGTTTCCGATCCACGCCGGCCTTGGCGGGAATCGCGAAGTAGTGGGTTCTCTCCCAGAACCAGCGAACATTTTCGCGGTTGAATTCGATCAAGCG
TTGCCAGAAGTCGCAAAGTTCGGTTGGCGCGTTGCCCAGCGAGAACGTGATCGGCTGAGCTGGCAACAAGCCCTCCAGGACCGACCAAGGCTCTGTGAAG
ACGTATGCTTCATACTCGTCTGGCGTGATGTTTGGTAGCCCGCTTTGCTGGATTGCCTTACTGTGAAGGTGGTAGTCGAGGATGGTGTGAGAAAAGAACG
GGATCTTGTCCACCCACCTGAGGAGCTGGGTGTGCGAGAACTGGCGACGGATCTTCTCGGCCATTGCTGGTGGAGCCACGAAGGGCCACTCAGCTTGATC
GCATGGACGGTAGCGTTCTTCAGGCGTAAATGTGTAATGGGGTTACACAGCCTGTAACTGGGTTACAGAGCAGTACAGTCGGACTGTACTGCGTTAGGTG
TGCCACACTAGCATTTATTGGGTACATTTTAGGATTAGTGTGACCAACACTAATCCATACATAAATTCGGTCGGAGCGTCCGTGACTAGTCATGGACGCC
TCCCAAAATACATGCATTAGGGATTAGAGGTTTGGTACCTAGGCAGAACGCTAAACAATAAGACAGTTCTCATTTTGGACACTAGCACAGACTTCCATTC
ATTTGTATTGAACTGTACAGTTTGTATACAAATTTGTATACGCTTCCTTACACTCCAGTAACCGAGCGTAAGCCTCGCCCGGTTACAAGTACCGCCTGAT
CTGCAGTGTGCCGGAGAACACGCCGAACCTGAGCCTGGCGCACGCTATCGAAGCGCTCTCAGGTGTGGAGGCTTCGGACGACTCGGCGTCAGGACAAGAA
TGCGCATTCACCTGGAAGCGCAAGGACCAAGGTAAGCGGCGCTTCACCGGCAAGTGCTACTACTGCCAAAAGCCAGG